ID: 920835079

View in Genome Browser
Species Human (GRCh38)
Location 1:209502993-209503015
Sequence GGGGCACCACACCCATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920835079_920835087 8 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835087 1:209503024-209503046 GCAGGTGAACCAGAATGGTGAGG No data
920835079_920835091 29 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835091 1:209503045-209503067 GGCCTGTAGGTATGAAGGTGTGG No data
920835079_920835088 16 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835088 1:209503032-209503054 ACCAGAATGGTGAGGCCTGTAGG No data
920835079_920835082 -10 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835082 1:209503006-209503028 GTGGTGCCCCTGAGGACTGCAGG No data
920835079_920835090 24 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835090 1:209503040-209503062 GGTGAGGCCTGTAGGTATGAAGG No data
920835079_920835086 3 Left 920835079 1:209502993-209503015 CCCTCAAATGGGTGTGGTGCCCC No data
Right 920835086 1:209503019-209503041 GGACTGCAGGTGAACCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920835079 Original CRISPR GGGGCACCACACCCATTTGA GGG (reversed) Intergenic
No off target data available for this crispr