ID: 920836992

View in Genome Browser
Species Human (GRCh38)
Location 1:209520206-209520228
Sequence CAAAAGATGAAAGACGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920836992_920836995 2 Left 920836992 1:209520206-209520228 CCTGTTACGTCTTTCATCTTTTG No data
Right 920836995 1:209520231-209520253 GTATTTCTCCATTTTGTAATGGG No data
920836992_920836994 1 Left 920836992 1:209520206-209520228 CCTGTTACGTCTTTCATCTTTTG No data
Right 920836994 1:209520230-209520252 TGTATTTCTCCATTTTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920836992 Original CRISPR CAAAAGATGAAAGACGTAAC AGG (reversed) Intergenic
No off target data available for this crispr