ID: 920837834

View in Genome Browser
Species Human (GRCh38)
Location 1:209528363-209528385
Sequence ACCAGCTGGCTCCTTTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920837829_920837834 11 Left 920837829 1:209528329-209528351 CCAGTCTTCTCCAGTGGGCAACA No data
Right 920837834 1:209528363-209528385 ACCAGCTGGCTCCTTTATAAAGG No data
920837831_920837834 1 Left 920837831 1:209528339-209528361 CCAGTGGGCAACAAAGTGGCAGG No data
Right 920837834 1:209528363-209528385 ACCAGCTGGCTCCTTTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920837834 Original CRISPR ACCAGCTGGCTCCTTTATAA AGG Intergenic