ID: 920839516

View in Genome Browser
Species Human (GRCh38)
Location 1:209542380-209542402
Sequence ATAGTAAGAAGCAGAATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920839516_920839518 18 Left 920839516 1:209542380-209542402 CCAATCATTCTGCTTCTTACTAT No data
Right 920839518 1:209542421-209542443 TGCAAGAAACCTGTAAGTTCAGG No data
920839516_920839519 19 Left 920839516 1:209542380-209542402 CCAATCATTCTGCTTCTTACTAT No data
Right 920839519 1:209542422-209542444 GCAAGAAACCTGTAAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920839516 Original CRISPR ATAGTAAGAAGCAGAATGAT TGG (reversed) Intergenic
No off target data available for this crispr