ID: 920841647

View in Genome Browser
Species Human (GRCh38)
Location 1:209560485-209560507
Sequence TAATGTACTTGGAGACTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920841647_920841650 11 Left 920841647 1:209560485-209560507 CCTAGAAGTCTCCAAGTACATTA No data
Right 920841650 1:209560519-209560541 TCTCTGCCAATGTTATAAAGTGG No data
920841647_920841651 12 Left 920841647 1:209560485-209560507 CCTAGAAGTCTCCAAGTACATTA No data
Right 920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920841647 Original CRISPR TAATGTACTTGGAGACTTCT AGG (reversed) Intergenic
No off target data available for this crispr