ID: 920841648

View in Genome Browser
Species Human (GRCh38)
Location 1:209560496-209560518
Sequence AGCAAGGCGAATAATGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920841648_920841651 1 Left 920841648 1:209560496-209560518 CCAAGTACATTATTCGCCTTGCT No data
Right 920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG No data
920841648_920841650 0 Left 920841648 1:209560496-209560518 CCAAGTACATTATTCGCCTTGCT No data
Right 920841650 1:209560519-209560541 TCTCTGCCAATGTTATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920841648 Original CRISPR AGCAAGGCGAATAATGTACT TGG (reversed) Intergenic
No off target data available for this crispr