ID: 920845582

View in Genome Browser
Species Human (GRCh38)
Location 1:209590591-209590613
Sequence ATGACGGCCTGTTCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920845582_920845592 23 Left 920845582 1:209590591-209590613 CCTCCTGGAGAACAGGCCGTCAT 0: 1
1: 0
2: 1
3: 7
4: 86
Right 920845592 1:209590637-209590659 AGTGATGGACGCCTGGCTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 118
920845582_920845591 16 Left 920845582 1:209590591-209590613 CCTCCTGGAGAACAGGCCGTCAT 0: 1
1: 0
2: 1
3: 7
4: 86
Right 920845591 1:209590630-209590652 AAGAGGGAGTGATGGACGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 222
920845582_920845586 -1 Left 920845582 1:209590591-209590613 CCTCCTGGAGAACAGGCCGTCAT 0: 1
1: 0
2: 1
3: 7
4: 86
Right 920845586 1:209590613-209590635 TTCCATGGAAGCTCCAGAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 213
920845582_920845589 8 Left 920845582 1:209590591-209590613 CCTCCTGGAGAACAGGCCGTCAT 0: 1
1: 0
2: 1
3: 7
4: 86
Right 920845589 1:209590622-209590644 AGCTCCAGAAGAGGGAGTGATGG 0: 1
1: 0
2: 2
3: 49
4: 406
920845582_920845587 0 Left 920845582 1:209590591-209590613 CCTCCTGGAGAACAGGCCGTCAT 0: 1
1: 0
2: 1
3: 7
4: 86
Right 920845587 1:209590614-209590636 TCCATGGAAGCTCCAGAAGAGGG 0: 1
1: 0
2: 0
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920845582 Original CRISPR ATGACGGCCTGTTCTCCAGG AGG (reversed) Intronic