ID: 920847905

View in Genome Browser
Species Human (GRCh38)
Location 1:209608887-209608909
Sequence CTGTGTATACAGTGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920847898_920847905 5 Left 920847898 1:209608859-209608881 CCACTGTTCTGGGACCTTCAGTG 0: 1
1: 0
2: 1
3: 24
4: 242
Right 920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 254
920847899_920847905 -9 Left 920847899 1:209608873-209608895 CCTTCAGTGCCCACCTGTGTATA 0: 1
1: 0
2: 1
3: 16
4: 135
Right 920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 254
920847896_920847905 15 Left 920847896 1:209608849-209608871 CCTGGTCACACCACTGTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 176
Right 920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG 0: 1
1: 0
2: 1
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920847905 Original CRISPR CTGTGTATACAGTGGGAGCT TGG Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
902728998 1:18356472-18356494 CTGTGAATACAGTGGGACACAGG + Intronic
903337657 1:22635625-22635647 CCATGTAGCCAGTGGGAGCTGGG - Intergenic
903770129 1:25758580-25758602 CTGTCTTTTCAGTGGGAACTGGG + Exonic
904596587 1:31650125-31650147 CTGTGGATGCTGTGGGAGCAGGG + Intergenic
905327893 1:37170852-37170874 CTGTGTATGCAGTGTGCACTGGG - Intergenic
905693093 1:39956685-39956707 TTTTGTATAAAGTGGGATCTCGG + Intronic
906020403 1:42623405-42623427 TTTTGTATACAGTGAGAGATAGG + Intronic
906650333 1:47508333-47508355 CTGTGTCAACAGTGCGGGCTGGG - Intergenic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
907604147 1:55799636-55799658 TTTTGTATACAGTGAGAGGTAGG + Intergenic
907855329 1:58297913-58297935 ATGTGTCTATAGTGGGAGATTGG + Intronic
909840350 1:80313286-80313308 ATGGGTGGACAGTGGGAGCTTGG - Intergenic
910361431 1:86416464-86416486 CTGTATATACAGTGTTAGCAAGG + Intergenic
911795266 1:102067720-102067742 TTTTGTATACAGTGAGAGATAGG - Intergenic
912313286 1:108644571-108644593 CTTTGAATAGAATGGGAGCTAGG - Intronic
912662565 1:111545791-111545813 TTTTGTATACAGTGTAAGCTGGG + Intronic
912788232 1:112624983-112625005 CTGTGCATACACTGTGTGCTTGG - Intronic
914967942 1:152277851-152277873 CTTTGGATTCTGTGGGAGCTGGG + Intergenic
916550343 1:165844121-165844143 CTGTGTATAGAGTGCCAGGTGGG + Intronic
916682888 1:167120337-167120359 CTGTATATACAATGTGACCTTGG + Intronic
916871073 1:168915386-168915408 CTGTATATATAAGGGGAGCTTGG - Intergenic
916986160 1:170193205-170193227 CTTTGTATACAGTGTGAGTTTGG + Intergenic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
918036427 1:180877492-180877514 CACAGTATACAGTAGGAGCTGGG - Intronic
920713481 1:208317399-208317421 CTGTGAATACAGTGAGACCTTGG - Intergenic
920713864 1:208320963-208320985 CTATGAATACAGTGAGACCTTGG - Intergenic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
922072337 1:222207113-222207135 TTTTGTATACGGTGGGAGCCAGG + Intergenic
922721065 1:227900560-227900582 CTATGTCTACAGGGGGACCTGGG + Intergenic
922910835 1:229215843-229215865 CTGAGATTACAGGGGGAGCTTGG - Intergenic
923766599 1:236897964-236897986 CTGTTTTTACAGTGGAATCTAGG + Exonic
1062775761 10:146050-146072 TTTTGTATAAGGTGGGAGCTAGG + Intronic
1064847185 10:19668265-19668287 CTGTGGTGACAGTGGGAGTTTGG - Intronic
1065195182 10:23257469-23257491 ATGTGACTAGAGTGGGAGCTGGG - Intergenic
1066101660 10:32123116-32123138 CTGTGGAGCCCGTGGGAGCTGGG - Intergenic
1067414506 10:46093242-46093264 GTGTGCATTCAGTGGGAGGTGGG - Intergenic
1069163596 10:65120477-65120499 TTTTGTATACAGTGAGAGGTGGG + Intergenic
1069397375 10:68004556-68004578 TTTTGTATACAGTGAGAGATAGG + Intronic
1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG + Intergenic
1070985926 10:80689869-80689891 CTGTGTCTACTGTAGGAGTTAGG + Intergenic
1072969783 10:100007352-100007374 TTGTGTATGCTGTGGGTGCTGGG - Intronic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077788327 11:5410008-5410030 CTGTGTATAGAATGGGATGTTGG - Intronic
1080847149 11:36036423-36036445 CTGTGTAGACACAGGGATCTTGG + Intronic
1082011677 11:47453895-47453917 CTGCGGACACAGTGGGATCTCGG + Intergenic
1082760581 11:57123537-57123559 CAGATTATACGGTGGGAGCTGGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085876383 11:80411357-80411379 TTTTGTATACAGTGAGAGGTAGG - Intergenic
1089900737 11:121981024-121981046 CTGTGTACACAAGGGGATCTTGG + Intergenic
1090006826 11:123010154-123010176 CTGTGTATAGTGTGGCAGCAAGG - Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090697171 11:129258488-129258510 TGGTGGATAGAGTGGGAGCTCGG - Intronic
1091336005 11:134766308-134766330 TTCTGTATACAGTGTGAGATAGG - Intergenic
1091679942 12:2519962-2519984 TTGTGTATACAGTGCGAAGTAGG + Intronic
1095131959 12:38553377-38553399 TTGTATTTACAGTGGGAGTTTGG + Intergenic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1101326094 12:103717143-103717165 CAGTGAATAGAGTGTGAGCTGGG + Intronic
1106105696 13:26731564-26731586 TTGTGTATACAGTGAGGGATAGG + Intergenic
1108854544 13:54776013-54776035 CTGTGGAGTCCGTGGGAGCTGGG - Intergenic
1109877259 13:68421666-68421688 TTTTGTATATAGTGGGAGGTAGG + Intergenic
1110068166 13:71135846-71135868 TTTTGTATACAGTGTGAGGTAGG - Intergenic
1110742289 13:79011890-79011912 CTTTGCATATAGTGAGAGCTAGG + Intergenic
1112398271 13:99053146-99053168 ATGTGAACACAGTGGCAGCTGGG - Intronic
1113675106 13:112201821-112201843 CTGTGTGCACATTGGAAGCTGGG + Intergenic
1115325755 14:32136032-32136054 CTTTTAATTCAGTGGGAGCTAGG + Intronic
1115465152 14:33707037-33707059 CTGTCTAAACAGTGTAAGCTTGG + Intronic
1118532232 14:66719012-66719034 CTGTGGATTGCGTGGGAGCTGGG - Intronic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1121418531 14:93796084-93796106 CTGAGTATACAGTTGGTGGTAGG - Intergenic
1121452966 14:94021133-94021155 CTCTGCCTCCAGTGGGAGCTTGG + Intergenic
1121567676 14:94923002-94923024 CTATGGATCCAGAGGGAGCTGGG - Intergenic
1124008888 15:25818907-25818929 TTGTGTATAGAGTGAGAGATAGG - Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126269470 15:46797656-46797678 TTTTGTATACAGTGAGAGATAGG - Intergenic
1126486546 15:49187752-49187774 TTGGGTAAACAGTGGGAGCCAGG - Intronic
1126858503 15:52861693-52861715 CTATGCAGACAGTGGCAGCTGGG - Intergenic
1127028994 15:54840773-54840795 CTGTGTTCCCAGTGTGAGCTAGG - Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129125537 15:73437700-73437722 CTGTGTATACTGTGTGAGAAGGG - Intergenic
1129140220 15:73591204-73591226 CTGTGTATCCAGTGATAGCAAGG - Intronic
1130038341 15:80381638-80381660 TTTTGTATACAGTGAGAGGTAGG - Intronic
1130364190 15:83218794-83218816 TTTTGTATACAGTGAGAGGTAGG - Intergenic
1130642981 15:85696821-85696843 CAGGGTATGTAGTGGGAGCTGGG + Intronic
1132313074 15:100871134-100871156 CTCTGTGTACAGTGGAAGTTAGG - Intergenic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1138416747 16:56876051-56876073 CTGGGTTTTCAGGGGGAGCTTGG - Intronic
1138495313 16:57405347-57405369 CGCTGTCTTCAGTGGGAGCTTGG - Intronic
1140663698 16:77211008-77211030 CTGTGTAGAAAGTGGGAACAGGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144357 16:88486675-88486697 CTAGGTACACAGTGGGTGCTGGG + Intronic
1142201450 16:88762920-88762942 CTGGGTATAAGGTGGGGGCTCGG - Intronic
1142358502 16:89615318-89615340 CTCTGTACCCAGTGGGAGCTGGG - Intronic
1145078830 17:19877491-19877513 CTGTGCATGCAGTGGGGGCAGGG + Intergenic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG + Intergenic
1153619721 18:6966105-6966127 GTGTGTATACAGTAGGGCCTAGG + Intronic
1156030256 18:32704849-32704871 CTGTCTACACAGTGGGCTCTGGG - Intronic
1156859817 18:41822812-41822834 CTGTGTATAGAGTGTGAGAGTGG - Intergenic
1157273418 18:46293754-46293776 CTGTGTATACAGCCAGGGCTGGG + Intergenic
1157322722 18:46646840-46646862 CTGTGTATATAGTCAGAGCTCGG - Intronic
1157538503 18:48480594-48480616 GTTTGTATACAGTGAGAGATAGG - Intergenic
1158373031 18:56831254-56831276 ATGTGTATAGAGTGGGAACAGGG + Intronic
1159843744 18:73432794-73432816 ATTTGTATACAGTGAGAGATAGG - Intergenic
1160125252 18:76165717-76165739 CTGTGTTCCAAGTGGGAGCTGGG + Intergenic
1160276654 18:77443543-77443565 CAGTGTATACTGTGGGAAATGGG - Intergenic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1163171862 19:15536932-15536954 GGGTGAATACAGTGGGAGGTTGG + Intronic
1164702801 19:30297779-30297801 ATGTGTATAGCATGGGAGCTTGG + Intronic
1165094649 19:33403493-33403515 TTGTGTTTACCGTGAGAGCTGGG - Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166382985 19:42364694-42364716 CTGTGAAGTCAGTGGGATCTGGG + Intronic
1166799373 19:45446697-45446719 CGGTGTAGAAAGTAGGAGCTGGG + Intronic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
926966433 2:18418787-18418809 GTTTGTATACAGTGAGAGATGGG + Intergenic
927467775 2:23350156-23350178 CTGTGCCTACAGTGGCAGCTTGG - Intergenic
927847314 2:26478209-26478231 CTGTGTTTCCTGTGGGACCTGGG - Intronic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
928550543 2:32366406-32366428 CTGTCTTTTCAGTGGGATCTTGG + Intronic
929918857 2:46158066-46158088 CTGAGTGTACAGTGGGAACCAGG + Intronic
933180834 2:79225328-79225350 CTATGTATACAGTAGTATCTGGG + Intronic
933806617 2:86002981-86003003 CTCTGCATACAGAGGGTGCTGGG - Intergenic
935650258 2:105375812-105375834 CTGGGTATGCACTGGGAGTTGGG + Intronic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
937290343 2:120778100-120778122 CTCTGTTTACAGTGGGTACTGGG - Intronic
937545298 2:123010063-123010085 CTTTGTATAGAGTGAGAGATAGG - Intergenic
937677616 2:124609162-124609184 CTCAGTATACAGTGGGAGCAAGG + Intronic
938755692 2:134377010-134377032 CTGTGTCAACAATGTGAGCTAGG - Intronic
941446959 2:165613568-165613590 TTTTGTATACAGTGAGAGATAGG + Intronic
941946572 2:171104974-171104996 TTTTGTATACAGTGAGAGATAGG - Intronic
942180521 2:173376317-173376339 TTTTGTATGCAGTGTGAGCTAGG + Intergenic
945161270 2:206893855-206893877 CTTTGTATACAGTGAGTGATAGG + Intergenic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
947040607 2:225914932-225914954 TTGTGTATACAATGAGAGATAGG + Intergenic
947218790 2:227773082-227773104 ATGTGTATACAGTGTATGCTGGG + Intergenic
1168801357 20:645458-645480 CTGTCTATACTGGGGGTGCTGGG - Intergenic
1170984769 20:21247452-21247474 TTTTGTATACAGTGTGAGGTAGG - Intergenic
1171250394 20:23641900-23641922 CGGTGTCTATAGAGGGAGCTTGG + Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1172663856 20:36585871-36585893 CTGGGTATACAGTGGTAGAATGG + Intronic
1173105156 20:40126903-40126925 CTGTGTGTACTCTGTGAGCTTGG - Intergenic
1173198038 20:40932169-40932191 TTGAGAAAACAGTGGGAGCTAGG - Intergenic
1173288062 20:41690689-41690711 CTCTGTATACGGTGGCATCTGGG - Intergenic
1173661433 20:44736974-44736996 CTGTCTGCACAGTGGAAGCTGGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175787928 20:61723761-61723783 GTGTGTTTACAGAGGGATCTGGG + Intronic
1176242659 20:64082325-64082347 CTCTGTATACAGTCTGGGCTTGG + Intronic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179570083 21:42273481-42273503 CTGTGTCTAATGTGGGCGCTGGG - Intronic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183112680 22:35662400-35662422 CTTTGAATAGAGTGGGAGGTGGG - Exonic
1184142759 22:42587974-42587996 CTTTGTATACAGTGGGAGTGTGG - Intronic
1184232790 22:43167651-43167673 CTGTGTTTCCAGGGGGTGCTGGG - Exonic
1184686780 22:46099809-46099831 CTGTGTATACAGGGAGGGCTGGG - Intronic
1184700230 22:46166070-46166092 GTGTATATACCATGGGAGCTGGG - Intronic
1185378858 22:50497182-50497204 CTGTGAATTAAGTGGGAGATTGG - Intergenic
953668059 3:44940222-44940244 ATGTGCATGCAGTGGGGGCTGGG - Intronic
953961244 3:47267585-47267607 CTATGTATACAGTGGGATATTGG + Intronic
953985891 3:47442754-47442776 CTTTTTACACAATGGGAGCTTGG - Intronic
954214138 3:49115151-49115173 CTGGGTGTGCAGTGGGTGCTAGG - Intronic
955607886 3:60725456-60725478 TTTTGTATACAGTGTGAGGTAGG + Intronic
956253639 3:67261136-67261158 GTGTATATCCAGTAGGAGCTGGG - Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
959277997 3:104302109-104302131 ATTTGTATACAGTGAGAGATAGG + Intergenic
961710445 3:128824159-128824181 CTGTGTCTACATGGGGTGCTGGG + Intergenic
963933012 3:151023826-151023848 CTTTGTATATGGTTGGAGCTTGG - Intergenic
964483968 3:157168233-157168255 TTGTGTATATTGTGGGGGCTGGG + Intergenic
967848571 3:194064393-194064415 TTTTGTATTCAGTGGGAGTTGGG - Intergenic
969136148 4:5030511-5030533 ATGTGGATACAGTGTGAGCCGGG + Intergenic
970353811 4:15232780-15232802 CTTAGTACACAGTGGGTGCTAGG - Intergenic
973811257 4:54572398-54572420 CAGTGGATACAGTGGGATCCAGG - Intergenic
974745703 4:66072627-66072649 GTGTGAATACAGTGGGTCCTGGG + Intergenic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978827973 4:113047616-113047638 CTGTGACCACAGTGGGAGTTGGG + Intronic
981843637 4:149141262-149141284 CTTTGTATACTGTGGGTGTTTGG + Intergenic
982927985 4:161363977-161363999 CTATGAATACAGTGGGAGTGGGG + Intergenic
982977015 4:162076624-162076646 CTGTGGATAAAGTGGATGCTGGG + Intronic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985673230 5:1217065-1217087 CAGAGCAGACAGTGGGAGCTGGG - Intronic
987648907 5:20714900-20714922 CTTTGTATACAGTGAAAGTTAGG + Intergenic
987828782 5:23068617-23068639 CTTTGTATACAATGAGCGCTAGG - Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
988353327 5:30141375-30141397 TTTTGTATACAGTGGCAGATAGG + Intergenic
992830062 5:80585280-80585302 CTGTGTGTACAGTGAGGGTTTGG + Intergenic
994051327 5:95365782-95365804 CTTTGTGTTCCGTGGGAGCTGGG - Intergenic
997701343 5:135902245-135902267 CTGTGGATACGGTGGGTCCTGGG + Intergenic
997978470 5:138454180-138454202 CTGTGTTTCCAGGGGGTGCTGGG - Intergenic
998181301 5:139946442-139946464 TTTTGTATACAGTGTGAGGTAGG - Intronic
998666290 5:144301548-144301570 CTATGTATATAGTAGGTGCTTGG + Intronic
999381439 5:151124122-151124144 CTCTCTATACTCTGGGAGCTAGG + Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003917715 6:10803090-10803112 CTGTCTGTACAGTGTCAGCTGGG + Intronic
1006101667 6:31689544-31689566 ATGTGTCTACAGTGGGGGATGGG + Intronic
1006559115 6:34894114-34894136 CGGTCTATACCTTGGGAGCTTGG + Intronic
1006905457 6:37530291-37530313 ATGTGTATACAGCAGGTGCTTGG + Intergenic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1007744656 6:44036166-44036188 ATGTCCATAGAGTGGGAGCTGGG + Intergenic
1010692567 6:78927704-78927726 TTTTGTATACAGTGAGAGATAGG + Intronic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1011295710 6:85825107-85825129 CTGTGGCTTCAGTGGGAGTTGGG - Intergenic
1011687247 6:89833322-89833344 CTGGGGATACAGTGAGAGCTGGG + Intronic
1012311273 6:97726493-97726515 CTGGGTGTACAGTGGCACCTGGG - Intergenic
1016250907 6:142041183-142041205 CTGTGTATGCAGTGGAAGAGTGG - Intergenic
1016934337 6:149437918-149437940 TTCTGTATACAGTGAGAGATGGG + Intergenic
1018689773 6:166335281-166335303 CGGTGGATACAGTGGCAGCAGGG + Intronic
1019115201 6:169754914-169754936 TTGTATATACAGTGTGAGCCTGG + Intronic
1022123396 7:27332310-27332332 CTGGGTACAGAGTGGGAACTGGG - Intergenic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1024479355 7:49848137-49848159 CTGTCTAACCAGTGGGGGCTGGG + Intronic
1024535412 7:50426929-50426951 CTGTGTGTACAGGGTGAGATGGG - Intergenic
1024763116 7:52624732-52624754 TTTTGTATACAGTGAGAGATAGG + Intergenic
1024798975 7:53054148-53054170 TTTTGTATATAGTGAGAGCTAGG + Intergenic
1029649389 7:101880482-101880504 CTGTATAAAGAGTGGGAACTGGG + Intronic
1029854697 7:103503742-103503764 CTGTTAATACAGTGGGATTTAGG + Intronic
1030486023 7:110168751-110168773 TTTTGTATACAGTGAGAGGTAGG + Intergenic
1031341133 7:120603478-120603500 CTGTATATGCAGTGGGGTCTGGG + Intronic
1031701693 7:124933999-124934021 CCGAGGATACAGTGAGAGCTAGG - Intergenic
1032895009 7:136240740-136240762 CTGTGAAGACCGTGGGACCTGGG - Intergenic
1034401093 7:150862035-150862057 CTGTGTTTACAGGTGGATCTTGG - Intergenic
1037897255 8:22666267-22666289 CTGAGTATACACTGGAAGATGGG + Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1042398473 8:68318008-68318030 CCGTGTGCAGAGTGGGAGCTGGG - Intronic
1043228801 8:77771648-77771670 TTTTGTATACAGTGAGAGATAGG - Intergenic
1045609855 8:103826395-103826417 TTGTGTATATAGTGTGAGGTAGG + Intronic
1047879968 8:129182282-129182304 CTGTGAATACAGTGGTGTCTTGG + Intergenic
1048786590 8:138057021-138057043 CTGATTATAAAGTAGGAGCTGGG - Intergenic
1048802194 8:138204468-138204490 CTGTGTATTCAGTGAAATCTAGG - Intronic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1050545604 9:6706293-6706315 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1052418362 9:28207257-28207279 CTATGTTTACAGTGGGAAATTGG - Intronic
1053014676 9:34655041-34655063 CTGGGTATACAGTGGGAAAGGGG + Intronic
1053107301 9:35421973-35421995 TTTTGTATACAGTGAGAGATTGG - Intergenic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1056830283 9:89911638-89911660 CTTTGTATATAGTGAGAGATAGG + Intergenic
1057510916 9:95678831-95678853 CTGGGTCTGCAGTGGCAGCTTGG + Intergenic
1058620168 9:106874435-106874457 TTGTGGATACAGTGAGAACTGGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059493930 9:114693942-114693964 CTATCTATACAGTGGGAGCAAGG - Intergenic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061458572 9:130717558-130717580 CTTTGGCTCCAGTGGGAGCTTGG - Intronic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1189194806 X:39143854-39143876 CTGTGTTTGCAGTGGGAGCATGG + Intergenic
1190107332 X:47569810-47569832 CTGTGTGGCCAGTGGGATCTGGG + Intronic
1192303995 X:69938768-69938790 CTTTGTTTACAGTGAGAGATAGG + Intronic
1192725473 X:73746774-73746796 TTTTGTATACAGTGAGAGATAGG + Intergenic
1194124801 X:90003170-90003192 TTTTGTATACAGTGAGAGATAGG + Intergenic
1194806884 X:98340346-98340368 TTTTGTATACAGTGGGAGACAGG + Intergenic
1195428321 X:104760950-104760972 TTTTGTATACAGTGAGAGATGGG + Intronic
1197148971 X:123198882-123198904 ATGTGTTTAAAGTGGGAGCATGG + Intronic
1197466031 X:126805613-126805635 TTTTGTATACAGTGAGAGATAGG - Intergenic
1197839272 X:130728166-130728188 CTGTGTGTGCTGTGGGAACTGGG - Intronic
1198882558 X:141296715-141296737 TTTTGTATACAGTGGGAGACAGG - Intergenic
1199138573 X:144283003-144283025 TTTTGTATACAGTGAGAGATAGG + Intergenic
1199887163 X:152031606-152031628 CTTTGAATACAGTGGGAGGCAGG + Intergenic
1200295149 X:154912372-154912394 TTTTGTATACAGTGAGAGATAGG + Intronic
1200477691 Y:3660778-3660800 TTTTGTATACAGTGAGAGATAGG + Intergenic
1200621341 Y:5453353-5453375 TTGTGTATACAGTGACAGATGGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic
1201726050 Y:17153144-17153166 TTTTGTATACAGTGGGAGATAGG - Intergenic