ID: 920848257

View in Genome Browser
Species Human (GRCh38)
Location 1:209611409-209611431
Sequence GTGGCTATTTACACTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920848257_920848263 11 Left 920848257 1:209611409-209611431 CCTGGATGAGTGTAAATAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 920848263 1:209611443-209611465 GTGTCCCCTCTTACATCCACAGG 0: 1
1: 0
2: 0
3: 11
4: 105
920848257_920848267 19 Left 920848257 1:209611409-209611431 CCTGGATGAGTGTAAATAGCCAC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 920848267 1:209611451-209611473 TCTTACATCCACAGGATTGACGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920848257 Original CRISPR GTGGCTATTTACACTCATCC AGG (reversed) Intronic
902045517 1:13521071-13521093 GTGGCTTTCTCCAATCATCCTGG - Intergenic
904519911 1:31086963-31086985 GAGGCTATTTACAGTAAACCTGG + Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906642281 1:47448764-47448786 GTGCCTCTTTCCACTCCTCCTGG + Intergenic
909668667 1:78164279-78164301 GTGACCATTTACACCCATTCTGG + Intergenic
910802632 1:91161051-91161073 GTGGCTCTTGAAACTCATCTTGG - Intergenic
911543955 1:99193076-99193098 GTGACTATTTGCCCTCATCATGG + Intergenic
913464475 1:119125689-119125711 GTAGATATTTACACTTATTCAGG + Intronic
917645482 1:177024971-177024993 TTGGCCATTTTCACTCTTCCTGG + Intronic
919075831 1:192811545-192811567 GTGGCTTTTTACACAAGTCCTGG - Exonic
920848257 1:209611409-209611431 GTGGCTATTTACACTCATCCAGG - Intronic
923984489 1:239365530-239365552 GTGTCTATTTTCTCTCATTCTGG + Intergenic
1079502503 11:21117197-21117219 GTGGCTATTTATATTGATCATGG - Intronic
1080115677 11:28619010-28619032 GTGGTTGTTTTCACCCATCCTGG - Intergenic
1085204147 11:74720470-74720492 GTGGCTTTTTACACAATTCCAGG + Intronic
1092161273 12:6316721-6316743 GTGGCCTTTTACACCCACCCAGG - Intronic
1093002831 12:14017262-14017284 GTGGCTATTTTCACTTTTCCAGG - Intergenic
1098573625 12:72015911-72015933 ATAGCTACTTACACTCATCCTGG + Intronic
1101230663 12:102737831-102737853 GGGGCTATTAGCACTCACCCAGG - Intergenic
1103403408 12:120658677-120658699 GTGGCTGTCTCTACTCATCCTGG + Intronic
1103890161 12:124232462-124232484 TTGGCTTTTTATAATCATCCAGG + Intronic
1107679972 13:42838257-42838279 GGGGCTATTCACATTCATCCAGG + Intergenic
1113042978 13:106124539-106124561 GTGCCTATTTACACATCTCCTGG + Intergenic
1116195997 14:41725647-41725669 GTGGCAATTTACAGTAATTCTGG - Intronic
1126432100 15:48597378-48597400 CTGGCTATTTCCACCCATCATGG + Intronic
1127452697 15:59132127-59132149 CTGGCTTTTTACTCTCTTCCTGG + Intergenic
1128129742 15:65218453-65218475 CTGGCTATTCACACTCACCATGG + Intergenic
1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG + Intronic
1143425291 17:6831518-6831540 GGGGCTATTCAGACTTATCCAGG - Intronic
1150479503 17:65498584-65498606 GAGGCTGTATACACTCAGCCAGG + Intergenic
1150823057 17:68451075-68451097 GTGGCTTTTTACCCTCTCCCAGG + Intronic
1151523887 17:74650504-74650526 GTGGCCATTTTCCCTCCTCCTGG - Intergenic
1157842459 18:50971303-50971325 GTAGCCATTTACCGTCATCCTGG + Intronic
1159908710 18:74122984-74123006 GTTTCTCTTTACTCTCATCCTGG + Intronic
1160416233 18:78713318-78713340 GTGGCTGTTTCTCCTCATCCCGG + Intergenic
1164504615 19:28849359-28849381 GTGGCTATCTTCACTCAGCTAGG - Intergenic
1166090915 19:40508344-40508366 GTGGCTCTTTACACCCACCATGG + Intronic
1166631183 19:44409445-44409467 GAGGCTATTTAAACCCACCCTGG + Intergenic
1166632061 19:44415572-44415594 GAGGCTATTTAAACTCACCCTGG + Intergenic
1166632481 19:44419241-44419263 GAGGCTATTTAAACCCACCCTGG + Intronic
1166636990 19:44459136-44459158 GAGGCTATTTAAACCCACCCTGG - Intergenic
1202649185 1_KI270706v1_random:165401-165423 GAGGCTATTTAAACCCACCCTGG + Intergenic
928392619 2:30921026-30921048 GGGGCAACTCACACTCATCCTGG - Intronic
938540967 2:132283129-132283151 GAGGCTATTTAAACCCACCCTGG - Intergenic
939099250 2:137876398-137876420 TAGGCTATTTAAACTCTTCCAGG + Intergenic
941099517 2:161281196-161281218 GAGGCTATTTAAACCCACCCTGG + Intergenic
948509276 2:238452583-238452605 GTTGCTATTTTTAATCATCCTGG - Intergenic
1171869877 20:30516134-30516156 GAGGCTATTTAAACCCAGCCTGG - Intergenic
1176602633 21:8807141-8807163 GAGGCTATTTAAACCCACCCTGG - Intergenic
1178905573 21:36633195-36633217 GTGGCCATCTCCACTCATCCTGG - Intergenic
1178923417 21:36755593-36755615 GTGGCTATTTCCCTCCATCCAGG + Intronic
1180344918 22:11698698-11698720 GAGGCTATTTAAACCCACCCTGG - Intergenic
1180352813 22:11818163-11818185 GAGGCTATTTAAACCCACCCTGG + Intergenic
1180385434 22:12174194-12174216 GAGGCTATTTAAACCCACCCTGG - Intergenic
1181450045 22:23013744-23013766 GTGGCTCATTTCACTCAGCCCGG + Intergenic
1181908273 22:26217142-26217164 GTGGCAACTTGCACTCCTCCAGG + Intronic
1182856370 22:33521038-33521060 GTGCCAAAATACACTCATCCAGG - Intronic
1183238943 22:36641316-36641338 TTGGCTATCTACACTGAGCCAGG - Intronic
1183323421 22:37178608-37178630 GTGGCTCTTAGCACCCATCCGGG + Intergenic
957327307 3:78713000-78713022 CTGGCTATTTTCACTCCTTCTGG + Intronic
958505316 3:94969145-94969167 TTGGCTATTTTCACTCTTACTGG + Intergenic
961902862 3:130231257-130231279 GTGGGTATTTACACTTATCTTGG - Intergenic
962649780 3:137476961-137476983 GTGACCATTTCCACACATCCTGG + Intergenic
966574744 3:181487807-181487829 GTGGCAATTTGCATTCAACCTGG - Intergenic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
972245104 4:37237960-37237982 GTGGCTCTTTCCACTCTTCCAGG - Intergenic
973375287 4:49282033-49282055 GAGGCTATTTAAACCCACCCTGG - Intergenic
973376183 4:49288039-49288061 GAGGCTATTTAAACCCACCCTGG - Intergenic
973378971 4:49306628-49306650 GAGGCTATTTAAACCCACCCTGG - Intergenic
973380123 4:49315021-49315043 GAGGCTATTTAAACCCACCCTGG + Intergenic
973382124 4:49328208-49328230 GAGGCTATTTAAACCCACCCTGG + Intergenic
990974741 5:61549421-61549443 GAGGCTATTAACAGTAATCCAGG + Intergenic
994741653 5:103626393-103626415 GTGGCCATATTCTCTCATCCAGG - Intergenic
995328552 5:110919870-110919892 GAGGCCATTTCCACTGATCCTGG - Intergenic
997268038 5:132509200-132509222 GTGGCTTTTAACACTTAGCCAGG - Intergenic
997430281 5:133833534-133833556 AAGGGTATTTACATTCATCCTGG + Intergenic
998004690 5:138649168-138649190 GTGTCCATTTACACACCTCCTGG - Intronic
1002593478 5:180306811-180306833 GTTGCTATTCACCCTCATTCAGG - Intronic
1004272698 6:14210000-14210022 GTTTCTATTTAAACTCATTCAGG - Intergenic
1004848105 6:19668062-19668084 GTTGCCATTCACACTCATCTTGG - Intergenic
1017550825 6:155505389-155505411 AAGGCTATTTATACTCTTCCAGG - Intergenic
1032753607 7:134866824-134866846 GTGGTTAGTTAAACTCAGCCTGG - Intronic
1039151830 8:34515164-34515186 GTGGCAGTTTTCACACATCCTGG + Intergenic
1046132075 8:109977722-109977744 ATAGCAATTTACACTCATCAAGG + Intergenic
1048624049 8:136164943-136164965 GTTGCTATTTACTCTATTCCAGG + Intergenic
1050555650 9:6787681-6787703 GAGGCAATTTACACTAACCCAGG - Intronic
1054873324 9:70069275-70069297 GTGGCTCTTTACACTTGACCAGG - Intronic
1055563655 9:77546845-77546867 CTGGCTATTTTAACCCATCCTGG - Intronic
1058151118 9:101464738-101464760 GAGGCTGTTTACACTTATTCAGG + Intergenic
1203698998 Un_GL000214v1:120262-120284 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203699957 Un_GL000214v1:126572-126594 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203700859 Un_GL000214v1:132556-132578 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203479695 Un_GL000224v1:1136-1158 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203480663 Un_GL000224v1:7432-7454 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203481624 Un_GL000224v1:13762-13784 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203549270 Un_KI270743v1:154594-154616 GAGGCTATTTAAACCCACCCTGG + Intergenic
1203550226 Un_KI270743v1:160908-160930 GAGGCTATTTAAACCCACCCTGG + Intergenic
1203567657 Un_KI270744v1:105273-105295 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203568716 Un_KI270744v1:112258-112280 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203569295 Un_KI270744v1:116510-116532 GAGGCTATTTAAACCCACCCTGG - Intergenic
1203570244 Un_KI270744v1:122791-122813 GAGGCTATTTAAACCCACCCTGG - Intergenic
1195945985 X:110212264-110212286 GTGGCTATTACCACTGATCGTGG + Intronic