ID: 920849998

View in Genome Browser
Species Human (GRCh38)
Location 1:209622353-209622375
Sequence GAGTGGGTGGGGAGGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1921
Summary {0: 1, 1: 3, 2: 25, 3: 206, 4: 1686}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920849998 Original CRISPR GAGTGGGTGGGGAGGGCAGA CGG Intronic
900118222 1:1037579-1037601 GAGTGGGTGGGGAGGCCGAGTGG + Intronic
900178153 1:1299703-1299725 GAGGGTGTGGGCAGGGCAGGTGG + Intronic
900255657 1:1697247-1697269 GAGTGGGTGGCCAGGACAGGTGG - Intronic
900264327 1:1749870-1749892 GAGTGGGTGGCCAGGACAGGTGG - Intergenic
900322934 1:2093931-2093953 GAGTGTGGGGCCAGGGCAGAGGG + Intronic
900394278 1:2446750-2446772 GAGGGGTTGGGGCTGGCAGAGGG + Intronic
900424159 1:2568457-2568479 GAGGAGGTGGGGAAAGCAGACGG - Intergenic
900436119 1:2632087-2632109 GGGTGGGTGGGGAGGGTGGGGGG - Intronic
900527044 1:3134470-3134492 GTGCGGGAGGGGAGGGCAGGAGG - Intronic
900536120 1:3178686-3178708 AAGTGGGTGGTGGGGACAGATGG - Intronic
900553479 1:3268471-3268493 GGGCGGCCGGGGAGGGCAGACGG + Intronic
900658538 1:3772084-3772106 GTGTGGGTGGGGAGCAGAGAAGG - Intergenic
900738044 1:4311646-4311668 GAGGAGGTCGGGAGGGGAGACGG - Intergenic
900998631 1:6136322-6136344 GGGTGGGTGGCGTGGGCACATGG - Intronic
901037989 1:6347926-6347948 GAGGGGCTTGGGAGGCCAGAGGG - Intronic
901040498 1:6360340-6360362 GCCTGGGTGGGGAGGGCTCAGGG - Intronic
901054353 1:6441849-6441871 GCTGGGGGGGGGAGGGCAGATGG - Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901229275 1:7633004-7633026 GAGGGGGTGAGGCAGGCAGAGGG - Intronic
901877274 1:12174009-12174031 GAGTGCGGGGGGAGGGCTGTTGG + Intronic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
901930959 1:12595857-12595879 GAGGGGGTGAGGAGGGGAGCCGG + Intronic
901941111 1:12662559-12662581 GAGTGGATGGAGGGGGCAGTAGG + Intronic
902117095 1:14130238-14130260 AAATGTGTGGGGAGGGCAGGTGG + Intergenic
902319884 1:15654272-15654294 GAATGGGTGTGGGTGGCAGATGG + Intronic
902336788 1:15758743-15758765 GAGGGGGCGGGGAGGGCGGACGG + Intronic
902511042 1:16967344-16967366 GACAGGCTGGGGAGGGCAGAGGG - Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
902542939 1:17167199-17167221 GAGGGAGGGGGGAGGGAAGAGGG - Intergenic
902649847 1:17829898-17829920 GGCTGGGTGGGGCTGGCAGAGGG + Intergenic
902771454 1:18647488-18647510 GGGTGGGGGGGGAGAGGAGAAGG + Intronic
902772176 1:18651806-18651828 GGGGGGGCGGGGAGGGGAGAGGG - Intronic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
902833599 1:19033409-19033431 GGCTGGGTGGGGAGGGTGGACGG - Intergenic
903009827 1:20321743-20321765 GAATGGATGGAGAGGGCACAGGG + Intronic
903502173 1:23806864-23806886 TGGTGGGTGGGGAAGACAGATGG - Intronic
903547704 1:24137025-24137047 GAGTGGGTGGAGGGTCCAGAAGG - Intronic
903603144 1:24556425-24556447 GCTTGGGTGGGGAGGGGACAAGG - Intronic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
903867625 1:26410678-26410700 GAGAGGGAGGGGAGGGGAGGGGG + Intergenic
903968153 1:27102391-27102413 GAGACGGTGGAGACGGCAGAGGG + Exonic
904032710 1:27543189-27543211 GAGGGAGTAGGGAGGGGAGAGGG + Intronic
904041823 1:27589900-27589922 GTGGGGGTGCTGAGGGCAGAAGG - Intronic
904081293 1:27873906-27873928 GGGTGAGTGCGGAGGACAGATGG + Intronic
904253593 1:29240777-29240799 GAGTGGCTGGGGAGGAGGGAGGG + Intronic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904542113 1:31239975-31239997 GAGTTGGGGGGAACGGCAGAGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905203222 1:36327853-36327875 CAGGGGGTGGGGAGGGCATGTGG - Exonic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905842823 1:41199283-41199305 AACTGGGAGGGGAGGGCACAGGG - Intronic
905894747 1:41538238-41538260 GTGTGGGTGGGGAGGTCTGGAGG + Intronic
905909456 1:41643836-41643858 GGGTGAGGGGGGTGGGCAGAGGG - Intronic
905990852 1:42335586-42335608 GGGGGGCGGGGGAGGGCAGAAGG - Intronic
906000615 1:42421361-42421383 GAGGGTGAGGGGAGTGCAGAAGG + Exonic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906627827 1:47340009-47340031 GAAGGGGAGGGGAGGGAAGAGGG - Intronic
906650500 1:47509219-47509241 GGGAGGGCGGGGAGGGCAGAAGG - Intergenic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907438005 1:54461938-54461960 GAGTGGGGGCTGGGGGCAGAGGG + Intergenic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
907615946 1:55926935-55926957 GAGGGAATGGGAAGGGCAGATGG - Intergenic
908002026 1:59689873-59689895 GAGGGGTTGGGGAGGGAGGAGGG - Intronic
908277852 1:62494657-62494679 CAGTTGGTGGGGGGGGCAGGAGG + Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
908703303 1:66924904-66924926 GAGGCGGAGGGGAGGGCAGAGGG + Intronic
908878230 1:68701713-68701735 GAGTTGGTGGGGAGGGTGCAGGG - Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909599242 1:77443920-77443942 GGGTGGGTGGGTAGGACAAAAGG - Intronic
909928995 1:81473140-81473162 GAGTGGGTGGGAGGGACAGAGGG + Intronic
909981478 1:82107022-82107044 GAAAAGGTGGGGAGGGAAGAAGG + Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910679110 1:89844086-89844108 GAGAGGGTGGAGAGGGCAGCTGG - Intronic
910777709 1:90892548-90892570 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
910839519 1:91547778-91547800 GATTTGGTGGGAAAGGCAGATGG + Intergenic
911267880 1:95764294-95764316 GAAGGGGTGGGGAGGGGAGGTGG + Intergenic
912452881 1:109778120-109778142 GGGTGGATGGGAAGGGCTGATGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913176565 1:116278107-116278129 GAGTGTGTGGGAAGGGCAAATGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
913522714 1:119661013-119661035 GAATGGGTGGGCAGGGCTAAAGG + Intronic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915120733 1:153628370-153628392 GAGTCGGTGGGGGGGTCAGCGGG + Intronic
915199947 1:154220247-154220269 GAGTGGGTGGAGAATGCAGACGG + Intronic
915279242 1:154810925-154810947 ATGTGGCTGGTGAGGGCAGAGGG - Intronic
915360360 1:155282835-155282857 GAGGAGGTGGGGTGGGGAGATGG + Exonic
915444435 1:155966795-155966817 GAGACGGCAGGGAGGGCAGAGGG - Intronic
915878817 1:159643453-159643475 GAGGGGGAGGGGAGGGGAGCGGG + Intergenic
916065267 1:161131741-161131763 AAGAGGGTGGGAAGGGCAGAAGG - Intronic
916075442 1:161197722-161197744 GAAGGGGTGGGGTGGGGAGAGGG + Intronic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916479491 1:165202231-165202253 GAGTTGGTGGGGAAGACAGCGGG - Exonic
916668485 1:166989537-166989559 GGGTGAGGCGGGAGGGCAGAAGG + Intronic
917105003 1:171483319-171483341 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
917905132 1:179580789-179580811 GAAGGGGTGGAGAGGGAAGAGGG + Intergenic
918006826 1:180549007-180549029 GATTGGGGGAGGAGGGCAGGAGG - Intergenic
918733119 1:188022996-188023018 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
918841773 1:189549839-189549861 GGGTAGGAGGGGAGGGGAGAAGG + Intergenic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919741325 1:200983167-200983189 CAGTGTGTGGGGTGGTCAGAGGG + Intronic
919775338 1:201190747-201190769 GGGTGAGTGGGAGGGGCAGAGGG + Intergenic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920285315 1:204874647-204874669 GCCTAGGTGGGGAGGGTAGAAGG - Intronic
920285357 1:204874864-204874886 GGGTGGGTGGTGGGGGCAGGTGG + Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920572839 1:207030959-207030981 GAGATGGTGGGGTGGGGAGAGGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
920869365 1:209781217-209781239 GAATGGCTGGGAAGGGAAGATGG + Exonic
921122993 1:212152904-212152926 AATAGGGTGTGGAGGGCAGAAGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921325926 1:213986254-213986276 GAGTGTGTGGGGGCGGCAAAAGG + Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921892399 1:220366430-220366452 GAGTGGGAGGTGAGGTCACAGGG + Intergenic
922022024 1:221715330-221715352 GGGAGGGTGGTGAGAGCAGAGGG - Intronic
922209889 1:223478954-223478976 GAGAGGGTGAGGAGGTGAGAGGG + Intergenic
922210009 1:223479294-223479316 GAGAGGGTGGGGAGGTGAGAGGG + Intergenic
922237005 1:223729602-223729624 AAGTGGATGGGGAAGGCACAGGG + Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922818890 1:228470588-228470610 GGATGGGTGGGGAGGGGAGCTGG + Intergenic
922933338 1:229407026-229407048 GGGCGGGAGGGGAGGGGAGAGGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923027179 1:230214349-230214371 GGGAGGCTGGGGTGGGCAGATGG - Intronic
923356829 1:233164865-233164887 TAGAGGCTGGGGAGGGGAGAAGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923514117 1:234680305-234680327 GTGTGTGTGGGGGGGGCATATGG + Intergenic
923534463 1:234838235-234838257 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
923602076 1:235412166-235412188 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602093 1:235412193-235412215 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602103 1:235412209-235412231 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
924761155 1:246988100-246988122 GGGTGAGTGGAAAGGGCAGAAGG - Exonic
1063091683 10:2871043-2871065 GCGGGGGTGGTGAGGGCAGTGGG - Intergenic
1063223430 10:3992498-3992520 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1063233484 10:4088736-4088758 GAGGGGGTGGAGCGGGCACACGG + Intergenic
1063459139 10:6204204-6204226 GGGCGGGTGGGCAGCGCAGAGGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063517626 10:6712259-6712281 GAGGGTGTGGGGAGGGGAGGAGG + Intergenic
1063565608 10:7170580-7170602 GAGTCGGTGGAGATGGCAGGGGG + Intronic
1063968830 10:11367373-11367395 GGGTGGGTGGGGACAGCAGGTGG - Intergenic
1064084879 10:12337936-12337958 GAATGGTTGGGGAAGGCTGAGGG + Intergenic
1064114791 10:12568383-12568405 GAGGGGAAGGGGAGGGGAGAAGG - Intronic
1064405554 10:15059135-15059157 GAGAGGGAGGGAAGGGGAGAGGG - Intronic
1064426098 10:15230956-15230978 GACTGGGTGGGGAGCACACAAGG + Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064767258 10:18687335-18687357 GGGTGGGAGGGAATGGCAGATGG - Intergenic
1064890082 10:20161518-20161540 GAGTGGGAGAGGACGACAGAGGG + Intronic
1065022405 10:21510729-21510751 GAGTACGTGGGGAGGGCTTAGGG - Intergenic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1065813116 10:29460667-29460689 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1066250259 10:33626192-33626214 GGGAGGGTGGGGAGGAGAGAGGG + Intergenic
1066334537 10:34462927-34462949 GAATGGGAGGGAAGGGGAGAGGG + Intronic
1066547697 10:36518792-36518814 AGGTGGGTGGGGAGGTCGGAGGG - Intergenic
1066569380 10:36754354-36754376 GAAGGGGAGGGGAGGGGAGAGGG + Intergenic
1066635225 10:37493147-37493169 GAATGGTTGGGGAAGGCTGAGGG + Intergenic
1067199525 10:44155333-44155355 GGGTGGGTGGGGTGGGGAAATGG + Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1068331699 10:55579735-55579757 GAGTGGAGGGTGAGGGCAAAGGG - Intronic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1069035967 10:63646214-63646236 CGGCGGGTGGGGAGGGCAGGGGG + Intergenic
1069595719 10:69668804-69668826 GAGGGGATGGGGAGAGGAGAGGG + Intergenic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069785704 10:70986531-70986553 GAGTGATGGGGGAGGGGAGAAGG + Intergenic
1069833520 10:71294979-71295001 GAGGCGCTGAGGAGGGCAGATGG - Intronic
1070368624 10:75760400-75760422 GAGTGGCTGGAAAGGGCAGCTGG + Intronic
1070733165 10:78845636-78845658 GAGTGGGTGCTCAGGGCAGGGGG - Intergenic
1070756107 10:78994193-78994215 GAGTGGCAGTGAAGGGCAGATGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070844835 10:79513472-79513494 GGATGAGTGGGGAGGGCACAAGG - Exonic
1070909009 10:80101018-80101040 GTGGGGGTGGGGAGGGCTAATGG + Intergenic
1070928970 10:80246835-80246857 GGATGAGTGGGGAGGGCACAAGG + Intergenic
1071021911 10:81067297-81067319 GAGCTGGTGGTGAGGCCAGATGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1072019629 10:91385296-91385318 GAGTGGGTGAGTAAGGAAGAGGG - Intergenic
1072693492 10:97586723-97586745 GAGTGGGTGGGTGGCCCAGAAGG - Intronic
1072713616 10:97734871-97734893 GAGTGGGTGGGGAGTGGCGATGG + Intergenic
1072785012 10:98273451-98273473 GAGAAGGTGGGGAAGGCAGCAGG - Intergenic
1073037509 10:100574645-100574667 GAGAGGGAGGGTAGGGGAGAGGG - Intergenic
1073056223 10:100704438-100704460 GAGGAGATGGAGAGGGCAGAGGG - Intergenic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073103284 10:101018322-101018344 GAGCTGGAGGGGTGGGCAGAAGG + Intronic
1073207365 10:101776155-101776177 GGGTGGGTGGGGAGGTGGGAGGG + Intronic
1073212737 10:101818148-101818170 GAGGGAGGGGGAAGGGCAGAGGG - Exonic
1073288843 10:102403471-102403493 CAGATGGTGGGGTGGGCAGAAGG - Intronic
1073349351 10:102808850-102808872 GAGTTGCGGGGGAGGGGAGATGG + Intronic
1073679427 10:105686279-105686301 GAGTGGGTGGTGGTAGCAGATGG - Intergenic
1074301244 10:112234983-112235005 GAGTGGGCGGTGAGAGCAGGAGG + Intergenic
1074326356 10:112455270-112455292 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1074941252 10:118237625-118237647 GATTGGGTGGGGAAGGTAGGAGG + Intergenic
1075129419 10:119725829-119725851 GAGCGGGAGGGGCGGGCGGAAGG + Intergenic
1075199923 10:120394103-120394125 GAGCTGGTGGGCAGGGGAGATGG + Intergenic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1075425865 10:122341432-122341454 GAGGGGCTGGGGCGGGCAGGAGG + Intergenic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1075802213 10:125160590-125160612 GGGAGGGTGGGGAGGGCGGGAGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076131580 10:128017514-128017536 GCCTGTGTGGGGAGGGCATATGG - Intronic
1076174317 10:128355430-128355452 GAGTAGGTGAGGAGGAGAGAAGG + Intergenic
1076530780 10:131142950-131142972 GAGTGGGAGCGGGAGGCAGAAGG + Intronic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076680217 10:132167879-132167901 GAGTGAGGGGCGAGGGCCGAGGG - Intronic
1076721398 10:132394978-132395000 GGGAAGGTGGGCAGGGCAGAGGG + Intergenic
1076899874 10:133333285-133333307 GAGGGGGTGGGGGGGGGGGAAGG + Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077020188 11:413879-413901 GGGAAGGTGGGGAGGGGAGAGGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1077185760 11:1234719-1234741 GCGGGGGCGGGGAGGGCAGCGGG + Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077186654 11:1238460-1238482 GAGGTGGGGGCGAGGGCAGAGGG + Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077449886 11:2634317-2634339 GGGTGGGGGGGGAGGGGGGAGGG - Intronic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077481748 11:2818251-2818273 GAGTGGGTGACAAGGGCACAAGG - Intronic
1077544189 11:3161970-3161992 GAGAGGGAGGGGAGGGGAGGGGG + Intronic
1077548910 11:3190744-3190766 GGAAGGGAGGGGAGGGCAGAAGG + Intergenic
1077684163 11:4275217-4275239 GGGCGGGTGGGGGGTGCAGAGGG + Intergenic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078461663 11:11519532-11519554 GAATGGATGTGGAGGGCAAAGGG + Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1079470626 11:20774160-20774182 GGATGGGAGGGGAGGGGAGAGGG - Intronic
1079683499 11:23326963-23326985 GGGTGGGTGGAGGGGGGAGAGGG + Intergenic
1079995779 11:27293618-27293640 GAGGGGGAGGGGAGGGGAGGCGG + Intergenic
1080360911 11:31512778-31512800 GAGGGGGGGCGGAGGGCAGGGGG - Intronic
1080646637 11:34192689-34192711 GAGAGAGTGGGAATGGCAGAGGG - Intronic
1080647511 11:34197543-34197565 TGGGGGGCGGGGAGGGCAGAGGG + Intronic
1080696691 11:34608892-34608914 GCCTGGGTGGGGAGGGCGAAAGG + Intergenic
1080770095 11:35332716-35332738 GAGTGTGTGTTCAGGGCAGATGG - Intronic
1080818938 11:35786944-35786966 TATAGGATGGGGAGGGCAGAAGG - Intronic
1081627153 11:44662956-44662978 GAGACCGTGGGGAGGGGAGAGGG - Intergenic
1081655304 11:44853293-44853315 GAGTGGGTGGGGAGAAGGGAGGG + Intronic
1081731836 11:45377205-45377227 GAGAGGGAGGGGAGGTGAGAGGG - Intergenic
1081737480 11:45414043-45414065 GGGTGGGTTGGGAGGGCTCATGG + Intergenic
1081813237 11:45924764-45924786 GTCTGGGAGGGGAGGGCATAAGG - Exonic
1081845569 11:46238267-46238289 GAGGGGGCCGGGAGGGCAGGAGG - Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1082767272 11:57179923-57179945 GAGAGGGTGGGAAGGGGGGAGGG + Intergenic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083253321 11:61482116-61482138 GAGTGGGTGGGCTGGGGACAAGG - Intronic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1083629052 11:64086451-64086473 GAGGGCATGGGGAGAGCAGAGGG - Intronic
1083630148 11:64091119-64091141 GAGAGGGTGGGGAGGGGGCATGG + Intronic
1083641479 11:64148102-64148124 GAGTGAGGGGGGCGGGCAGGGGG + Intronic
1083747107 11:64742769-64742791 GAGTGGCTCGGGAGGGCACACGG - Intronic
1083750704 11:64759204-64759226 GTGGGGGAGGGGCGGGCAGACGG - Intronic
1083897281 11:65626213-65626235 GAGTCGGTGGAGAGCGCAGCCGG - Intronic
1084104892 11:66975015-66975037 AAGGGGGAGGGGAGGGGAGAAGG + Intergenic
1084421611 11:69063315-69063337 GAGTGGGAGGGGACGGCAGAGGG - Intronic
1084473463 11:69376147-69376169 TAGTGGGTGGGGTGGGGAGTTGG - Intergenic
1084553989 11:69865027-69865049 GAGTGGGTGGCGGGTGCACAGGG + Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084708438 11:70829494-70829516 GTGGGGGTGGGCGGGGCAGAGGG - Intronic
1084933218 11:72573458-72573480 GAGGGGGTGGGGTGGGGTGAGGG - Intergenic
1085035418 11:73297062-73297084 TAGTGGGTGGCCAGGGCAGGCGG - Exonic
1085068618 11:73521366-73521388 GAGAGGGTGGGTAGGGTAGTAGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085101058 11:73800409-73800431 GAGTGGGTGGTGAGAGCAGTGGG - Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085284363 11:75350470-75350492 TAGGGGGTGGGGAGGGCAACGGG + Intronic
1085308138 11:75500063-75500085 GAATGGCTGTGGAGGGCTGAGGG - Intronic
1085592641 11:77778204-77778226 GAGAGGATGGGGAGGGGAGGGGG + Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087318138 11:96628780-96628802 GACTGGGTGGGGTGGGGTGAGGG + Intergenic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088484178 11:110325229-110325251 AGGTGGTTGGGGAGGCCAGAAGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089132194 11:116221529-116221551 GAGTGGGTGGGGGGGGAACCAGG - Intergenic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089402870 11:118174672-118174694 GAGTGTTTGGGGTGGGGAGATGG - Intronic
1089458416 11:118639043-118639065 AAGTGGGAGGGGAGTGCAGAAGG + Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089574575 11:119432353-119432375 GAGTGAGTGGGGAGACAAGATGG + Intergenic
1089636520 11:119817304-119817326 GGGTGGCTGGGGAGGTCAGTTGG - Intergenic
1089644712 11:119871147-119871169 GAAGTGGTGGGGAGGGCAGTGGG + Intergenic
1089650794 11:119911495-119911517 GTGGGACTGGGGAGGGCAGATGG - Intergenic
1089665612 11:120016413-120016435 GAGTGGGTGGTGGGGACTGAAGG - Intergenic
1089704615 11:120268932-120268954 GAGTCTGTGGGGAGGACAGCTGG - Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090306210 11:125693386-125693408 GAGTAAGTGGGTAGGGGAGAAGG - Intergenic
1090394097 11:126407683-126407705 GAGTGGGGGGAGCGGGCAGGGGG - Intronic
1090405399 11:126473241-126473263 GAGTGGGTGGGGAGGGGGCTAGG - Intronic
1090639192 11:128716233-128716255 GAGGGGGTGGGGAGAGAAGGAGG - Intronic
1090967689 11:131613258-131613280 GGATGGGTGGGGAGGGCATCAGG - Intronic
1091197895 11:133747416-133747438 GAGAGGGTGGGAAAGGCAGGAGG - Intergenic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1091314810 11:134606829-134606851 GTGAGGGTGGGGAGTGCTGAAGG + Intergenic
1091361038 11:134978599-134978621 GCGAGGGAGGGAAGGGCAGAGGG + Intergenic
1091381962 12:67435-67457 GAGTGAGCGGGGAGAGGAGATGG + Exonic
1091390533 12:123607-123629 GAGAGTGCTGGGAGGGCAGATGG + Intronic
1091404267 12:199141-199163 GGGAGGGTGGGGAGGGGAGGAGG + Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091714750 12:2768793-2768815 GAGTGAGGAGGGAGGGCCGAGGG - Intergenic
1091991235 12:4957711-4957733 GAATGGGTGGGGAGAGCAAAAGG - Intergenic
1092060629 12:5547628-5547650 GGTGGGGTGGGCAGGGCAGAGGG + Intronic
1092118136 12:6024094-6024116 GAGTGGGTTGTGAGGACAGATGG - Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092246290 12:6866224-6866246 GAATGGCTGGGCAGAGCAGAGGG + Exonic
1092499347 12:9030224-9030246 TAGTGGATGGGGTGGGCAGGTGG + Intergenic
1092570439 12:9715712-9715734 CAGTGGGTGGGGATGGCAACTGG - Intergenic
1092793100 12:12086402-12086424 GGGGAGGTGGGGTGGGCAGATGG - Intronic
1092817263 12:12322979-12323001 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817297 12:12323035-12323057 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
1092817333 12:12323108-12323130 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094201338 12:27797516-27797538 GAGTGGGAGGTGAGTGCGGATGG + Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095502207 12:42852382-42852404 TAGAGGGTGGGAAGGGTAGAGGG + Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095961067 12:47834744-47834766 GAGTGGATGGGGAGGGCGGTGGG - Intergenic
1096079207 12:48822688-48822710 TAGGGGGTGGGGAGAGCAAAGGG + Intronic
1096255005 12:50057585-50057607 GAGGGGAGGGGGAGGGGAGAGGG - Exonic
1096493035 12:52023375-52023397 GAGTGGGGTGGGAGCGCAGAGGG + Intronic
1096512259 12:52137558-52137580 GAGTGGGAGGAGAGGGCATGTGG + Intergenic
1096519023 12:52173792-52173814 GGGCTGGTGGGGAGGGCACAAGG + Intronic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096570442 12:52520108-52520130 GAGTGGGTGGCTATGGCAGCCGG - Exonic
1096621385 12:52867854-52867876 GAGTGGCTGGGGAGAGCACGTGG - Intergenic
1096623637 12:52879799-52879821 GGGTGGGTGGGGGGAGCTGAGGG - Intergenic
1096625903 12:52895905-52895927 GAGTGGGAGGGGTTGGCAGTGGG + Intergenic
1096626887 12:52901364-52901386 GTGAGGGTGGAGAGGGCAGCTGG - Intronic
1096653768 12:53075703-53075725 CAGTGGGTGGGCAGAGCAGGGGG - Intronic
1097040506 12:56153414-56153436 GAGTGGAGGGGCTGGGCAGATGG + Intronic
1097051171 12:56224245-56224267 GATTGGCTGGGCAGGGCAGGCGG + Intronic
1097054810 12:56243024-56243046 GACTGGGTGGAGGGGGCGGAGGG - Exonic
1097059531 12:56272224-56272246 TGGGGGGTGGGGAGGTCAGAAGG + Exonic
1097214325 12:57398110-57398132 GTGGGGGTGGGCAGGGGAGAGGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097293453 12:57939894-57939916 GAGTGGGAGGGGAAGGGTGAGGG + Intergenic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1097644588 12:62221172-62221194 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1097731692 12:63135329-63135351 GAGTGGGTGGTGAGCCGAGATGG + Intergenic
1097958741 12:65512279-65512301 GAGAGGGAGGGGAGGACAGAAGG - Intergenic
1098488007 12:71044352-71044374 GAGTGGGTGGTAAGGTGAGAAGG - Intergenic
1099032517 12:77544916-77544938 GCTTGAGTGGGGAGGGTAGAGGG + Intergenic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1099886038 12:88532149-88532171 GAGTGAGTGGGGAGGATGGAGGG + Intronic
1100695436 12:97087647-97087669 GACTGGTTGGGGTGGGCAGGGGG + Intergenic
1100854294 12:98745471-98745493 GAGGTGGTGGGGAGGGGAGTCGG + Intronic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101640231 12:106581950-106581972 GGTGGGGTGGGGAGGGCAGGGGG + Intronic
1101676588 12:106922440-106922462 CAGAGGGTGGGAAGGGCAGTGGG - Intergenic
1101909531 12:108850829-108850851 GAGCTGGTGGGGAGGGCAGTTGG + Intronic
1102000161 12:109552600-109552622 GAGTGGGTGGGGGAGACAGGTGG - Intergenic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102027003 12:109719380-109719402 GAGTGGGTGGGAAGAGGAGTGGG - Intronic
1102027708 12:109722995-109723017 GAGCGGGTGGGGGGGGGAGGGGG + Intronic
1102139037 12:110599314-110599336 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102921453 12:116794629-116794651 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1102963294 12:117107594-117107616 GCGGGGCTGAGGAGGGCAGATGG + Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103009600 12:117448076-117448098 GAGTGTGTGGGGTGAGCAGTAGG + Intronic
1103328938 12:120140471-120140493 GTGTGAGTGGGTAGGGCAGGAGG - Intronic
1103398938 12:120629189-120629211 GAGTGGATCTGGAGGGCAAATGG + Intergenic
1103568481 12:121829100-121829122 GATGGGGTGGGCAGGGCTGAGGG + Intronic
1103738850 12:123078088-123078110 GAAGGGGTGGGGAGCGGAGAGGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103948863 12:124541066-124541088 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1103949034 12:124541599-124541621 GAGCAGGTGGGGAGTGGAGATGG + Intronic
1103949132 12:124541849-124541871 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104047558 12:125173860-125173882 GAGTGGGGGGGGTGGGCTGGTGG + Intergenic
1104267729 12:127252170-127252192 GAGTGAGTGGTGAGAGCTGATGG - Intergenic
1104372610 12:128237132-128237154 GGGTGGGTGGGGAGTGGGGAGGG - Intergenic
1104544435 12:129698597-129698619 GGGAGGGAGGGGAGGGGAGACGG + Intronic
1104544466 12:129698652-129698674 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1104601152 12:130154343-130154365 GAGTGGGTGCAGAGAGCTGAGGG - Intergenic
1104626785 12:130363267-130363289 GAGGTGATGGGAAGGGCAGAGGG + Intronic
1104673933 12:130700082-130700104 GGGTGGCTGGGGAGGGAACATGG - Intronic
1104674482 12:130703479-130703501 GAGGGATTGGGGAGGGCAGGCGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104931704 12:132342518-132342540 GAGCAGGTGGGCAGGGGAGACGG - Intergenic
1104976986 12:132556594-132556616 GGGTGGGTGGCGGGGGCAGCAGG - Intronic
1105202340 13:18191146-18191168 GAGTGGGTGGGGAGGGCAAGAGG + Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105348328 13:19593945-19593967 TAGAGGCTGGGAAGGGCAGAGGG + Intergenic
1105448758 13:20479983-20480005 GAGTGGATGGGGAGGTCACCTGG - Intronic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106269231 13:28138298-28138320 AAGCGGGTGGGGAAGGCGGAGGG - Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1107383530 13:39882567-39882589 GAGTGGGTCTGCAGGGCAAAGGG + Intergenic
1107389730 13:39951474-39951496 GGGTGGATGGGGAGGGGAGGGGG + Intergenic
1107484453 13:40813108-40813130 GGGGGGGGGGGGAGGGCAGGTGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107938002 13:45361324-45361346 GAGGGGGAGGGGACGACAGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1108801924 13:54108571-54108593 GGGTGGGTGGGGGCGGCAGACGG - Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110739549 13:78978377-78978399 GTATAGGTGGGGAGGGGAGAGGG + Intergenic
1110749290 13:79093884-79093906 GCGTGGGGGGGGAGGGGGGAGGG + Intergenic
1111133944 13:84014139-84014161 GAGTGGGTGAGGAAAGGAGAAGG + Intergenic
1111146928 13:84194649-84194671 GAATGGGTGGGGAGGAGGGAGGG - Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111584579 13:90268291-90268313 AGGTGGATGGGGAGGCCAGAAGG + Intergenic
1111640081 13:90957597-90957619 GTGGGGGTGGGGGGGGGAGAGGG - Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112566197 13:100552982-100553004 GGGTGGCTGGGGAGGGGAGGGGG + Intronic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1113218283 13:108068972-108068994 AAGTGGGTGGGGAGGTGAGGGGG - Intergenic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113909813 13:113836560-113836582 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909825 13:113836582-113836604 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909839 13:113836604-113836626 GAGGGGGTGGGGAGGGGTGGGGG + Intronic
1113917809 13:113884537-113884559 GGGTGGGTGGAGAGAGCAGCAGG - Intergenic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1113993274 14:16045555-16045577 GGGTGGGTGGGGTGGGGTGAGGG + Intergenic
1114263354 14:21055711-21055733 GAGAGGGTGGGGATGGTAGCAGG - Intronic
1114464370 14:22910526-22910548 GGATGGGAGGAGAGGGCAGAGGG + Intronic
1114529790 14:23388550-23388572 GTGTGGGGGGTGAGGGCAGGGGG - Intronic
1114628888 14:24147003-24147025 GAGTGGGAGGGGCAGCCAGAGGG + Exonic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1115063430 14:29223546-29223568 TGGTGGGTGGGGTAGGCAGAAGG - Intergenic
1115217366 14:31026374-31026396 GAGTGAGTGAGACGGGCAGATGG - Exonic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116746776 14:48830155-48830177 GAGAGGGGGGAGAGGGGAGAGGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118157745 14:63257649-63257671 GGGTGGGTGGGGAAGGAATATGG - Intronic
1118289233 14:64504631-64504653 GAGTGGGTGGGCGGGCGAGAGGG + Intronic
1118330595 14:64812650-64812672 CAGTGGGTGGGGCTGGCAGCTGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118485207 14:66208102-66208124 GAGGGGCTGGAGAGGGCAGAAGG - Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118775622 14:68972157-68972179 GACTGGGTGGGTTGGGGAGAGGG - Intronic
1118835365 14:69474072-69474094 GAGTGGGTGGGGAGGGTGCCTGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119092979 14:71801602-71801624 TGGTGGGTGGGGGGAGCAGAGGG + Intergenic
1119105606 14:71920436-71920458 GAGCTGGTGAGGAGGGCTGATGG + Intergenic
1119205170 14:72788641-72788663 GAGGTGGGGAGGAGGGCAGAGGG - Intronic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119442574 14:74638117-74638139 GAGTGGGTGGTGAGGGCCTGAGG + Intergenic
1119768610 14:77206220-77206242 GAGGGGGTGGGGAGGTGGGAGGG + Intronic
1119898123 14:78238057-78238079 GGAGGGGTGGGGAGGGCAAATGG + Intergenic
1119932030 14:78556945-78556967 GAGGGGAGGGGGAGGGGAGAAGG - Intronic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120359843 14:83485422-83485444 GCGGGGGGGGGGGGGGCAGAGGG - Intergenic
1120852819 14:89186544-89186566 GAGAGGGTGGGGTAGGCAGATGG + Intronic
1121021806 14:90584792-90584814 GAGATGCTGTGGAGGGCAGAGGG + Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1121468173 14:94129301-94129323 GAGTGCCAGGGGAAGGCAGAGGG + Intronic
1121529899 14:94644862-94644884 GAGGGGGTGTGTGGGGCAGAGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1122081046 14:99268272-99268294 GTGGCGGTGGGGAGGGGAGAGGG - Intronic
1122292562 14:100687497-100687519 GGGTGGGTGGAGAGGCCAGGAGG + Intergenic
1122388959 14:101367561-101367583 GAGTCGATGCGGAGGGGAGAGGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122706505 14:103625260-103625282 AAGAGGGTGGGGAGGAAAGAGGG - Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122854586 14:104554106-104554128 GAGTGGATGGGTTGGGCAGTGGG - Intronic
1122979332 14:105184609-105184631 GAGGGGTTGGGCAGGGCAGGTGG + Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123117096 14:105899713-105899735 GGGTGGGTGGGGTGTGCAGGTGG + Intergenic
1123119171 14:105909022-105909044 GGGTGGGTGGGGTGTGCAGGTGG + Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123541081 15:21292151-21292173 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123673924 15:22689838-22689860 GGGTGGGATGGGAGAGCAGAGGG - Intergenic
1123904319 15:24906949-24906971 GGCTGGCAGGGGAGGGCAGAGGG + Intronic
1123991501 15:25687034-25687056 GAGAGGGTGGGAAGGCCCGAAGG + Intronic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124065806 15:26342626-26342648 GAGTGGGTAGGGAAGACAGGAGG - Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124431372 15:29611564-29611586 AAGTGGCTGGGAAGGGCAGAGGG - Intergenic
1124621932 15:31278851-31278873 CAGTGGGTGGGGTGGGCATGAGG + Intergenic
1124816637 15:33000539-33000561 GAGAGGCTGAGGTGGGCAGATGG + Intronic
1124959087 15:34381902-34381924 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1124975713 15:34528123-34528145 GTGTGGGTGGGGTGGGCATGAGG - Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125507559 15:40275786-40275808 GAGGGGGTGGGGAGGGACAAGGG + Intronic
1125697557 15:41651816-41651838 GAGGGGGAGGGGAGAGGAGAAGG - Intronic
1125723087 15:41854407-41854429 GGGAGGGTGGGGAGAGGAGAGGG + Intronic
1125832768 15:42728383-42728405 GGGTGGGGCGGGAGGGCAAACGG - Intronic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1126069626 15:44854555-44854577 GAGTGGGCTGGTAGGGCAGCGGG - Intergenic
1126088905 15:45034608-45034630 GAGTGGGCTGGTAGGGCAGCGGG + Intronic
1126222982 15:46236303-46236325 GAGAGAGTTGGGAGGGCCGAAGG + Intergenic
1126406906 15:48331523-48331545 GAGCGCGGGGCGAGGGCAGAGGG - Exonic
1126426226 15:48529462-48529484 GAAAGAGTGTGGAGGGCAGATGG + Intronic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127065559 15:55234187-55234209 GTGTTGGAGGGGAAGGCAGAAGG - Intronic
1127281566 15:57497676-57497698 GTGTGGGTGGGCCAGGCAGAGGG + Intronic
1127470104 15:59282877-59282899 GAGAGGGAGGGGAGGGGGGAGGG + Intronic
1127507578 15:59610933-59610955 GAGGGGGAGGGGGAGGCAGAGGG - Intronic
1127507589 15:59610955-59610977 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507606 15:59610982-59611004 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127657798 15:61071657-61071679 GGAGGGGTGGGGAGGGGAGAGGG + Intronic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128241480 15:66104271-66104293 GCTTGGCTGGGGTGGGCAGAGGG - Intronic
1128834113 15:70795238-70795260 GGGAGGGTGGGGATGGGAGATGG + Intergenic
1128998137 15:72311916-72311938 GCTTGGGTAGAGAGGGCAGATGG - Intronic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129464251 15:75715129-75715151 GAGGGGGTGGGGGGGGGAGATGG - Intergenic
1129653250 15:77506343-77506365 GAGAGGGAGGGGAGTGCACAGGG - Intergenic
1129686974 15:77691899-77691921 GCGTGGGTGGGGGTGACAGATGG - Intronic
1129872178 15:78947620-78947642 AAGTGGCTGGGATGGGCAGAGGG - Intronic
1129893917 15:79090036-79090058 GAGTGACTGCGGCGGGCAGAGGG - Intronic
1130006854 15:80107860-80107882 GATGGGGTTGGGAGGGCAGCGGG + Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130136882 15:81188933-81188955 GAGTGCTTTGGGAGGACAGAAGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130510708 15:84587051-84587073 GAGAGGATGGGGAGGGGAAAAGG - Intergenic
1130630080 15:85558957-85558979 GAGGGGGAGGGGACGGCAAAGGG - Intronic
1130736938 15:86560281-86560303 GCGGGGGTGGGGAGGGGGGAGGG - Intronic
1130828378 15:87573101-87573123 GAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1130899853 15:88199102-88199124 GACAGGGTGGGGTGGGGAGAAGG + Intronic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131091745 15:89629142-89629164 GAGAGGGTGGTGAGGGCTGCAGG + Intronic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1131546367 15:93319306-93319328 CAGAGGGTGGGGCCGGCAGAGGG - Intergenic
1132100853 15:99021920-99021942 GAGTGCCTGGGGAGGGCAAGAGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132240399 15:100253367-100253389 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240407 15:100253385-100253407 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240415 15:100253403-100253425 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240423 15:100253421-100253443 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240431 15:100253439-100253461 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240439 15:100253457-100253479 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240454 15:100253493-100253515 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1202949394 15_KI270727v1_random:19292-19314 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1132515540 16:364173-364195 GAAGGGGTGGGGTGGGCATAGGG + Intergenic
1132535009 16:474439-474461 GAGTAAGTGGGGAGAGTAGAAGG + Intronic
1132664681 16:1076080-1076102 GAGGGGGAGGGGAGGAGAGAGGG - Intergenic
1132666564 16:1083597-1083619 GAGTGGGTGGGGTGGGGACGGGG + Intergenic
1132678584 16:1130687-1130709 CAGCGGATGGGGACGGCAGAGGG + Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132933781 16:2471269-2471291 GAGGGGGTGGGGGGCGCAGCAGG - Intergenic
1132974986 16:2706659-2706681 TGGAGGGTGGGGAGGGCAGGGGG + Intronic
1133069536 16:3235849-3235871 GGGGGGGTGGGGAGGGTAGGGGG - Intronic
1133268822 16:4600536-4600558 GTGGGGGTGGGGGGGGCATATGG - Exonic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1133834900 16:9359119-9359141 GAGAGGCTGAGGTGGGCAGAGGG - Intergenic
1133876638 16:9740999-9741021 GAGTGGGTGGGGTGTGCTCAAGG - Intergenic
1133894450 16:9912504-9912526 AAGTGGGTGGGGTGGGGGGAGGG + Intronic
1134079531 16:11315577-11315599 GAGGGGGAGGGGAGGGCTAAGGG - Intronic
1134203302 16:12216700-12216722 GGTGGGGTGGGGAGGGCACATGG - Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134449511 16:14354475-14354497 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449521 16:14354497-14354519 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449536 16:14354536-14354558 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449674 16:14355425-14355447 GAGTGGGGGGGGGGGGCGGGGGG + Intergenic
1134693090 16:16203793-16203815 GAGTTGGGGGGCAGGGCAGGAGG + Intronic
1134978758 16:18590902-18590924 GAGTTGGGGGGCAGGGCAGGAGG - Intergenic
1135164773 16:20129560-20129582 GGGGGGATGGGGAGGGAAGAAGG - Intergenic
1135393850 16:22115945-22115967 GAGGGGGTGGGGAGGGAGGGAGG + Intronic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135563175 16:23492344-23492366 GAGGTGGTGGGGCGGGCAGGGGG + Intronic
1135572957 16:23563346-23563368 GCGGGGGTGGGGCAGGCAGAGGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136083408 16:27867755-27867777 GAGTGGGTGGGTGGGGCCGCCGG - Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136517877 16:30778761-30778783 GAGTCAGTGGGGAAAGCAGAGGG - Exonic
1136520870 16:30795000-30795022 GGGTGGGGGGTGAGGGCAGCAGG - Intergenic
1136813602 16:33199227-33199249 GGGTGGGGGGGGAGGGGAGTGGG + Intronic
1136820078 16:33309307-33309329 GGGTGGGGGGGGAGGGGAGTGGG + Intergenic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137601592 16:49760026-49760048 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601617 16:49760139-49760161 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137601637 16:49760228-49760250 GGGTGGGTGGGGTGGGTAGATGG + Intronic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1138197207 16:55060485-55060507 GAGTGGGTGAGGCAGGCAGCAGG - Intergenic
1138621584 16:58215675-58215697 CAGTGGGTGGGGATGACAGCAGG - Intergenic
1138654211 16:58481489-58481511 GTGTGGTTGGTGAGGGCATAGGG + Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139372104 16:66475393-66475415 GACTGGGTGGGCAGCGCTGAGGG - Intronic
1139465708 16:67153003-67153025 GAGTGGGTGGGGTGGCCCCAGGG - Intergenic
1139527612 16:67526435-67526457 GAGTGGGTGGGCATGGTAGGGGG + Intronic
1139654754 16:68380590-68380612 GAGGTGGTGCTGAGGGCAGAGGG - Intronic
1139665710 16:68454029-68454051 GCCTGGATGGAGAGGGCAGATGG + Intergenic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1139925368 16:70483015-70483037 GAAGGGGTGGGGAGAGGAGAGGG - Intronic
1139945468 16:70638508-70638530 GAGAGAGTGGGGGGGTCAGAAGG - Intronic
1141068796 16:80934772-80934794 TAGTGGGTGGAGGGGACAGATGG - Intergenic
1141173375 16:81704556-81704578 GAGTGGGTGGGGGGGTGAGGGGG - Intronic
1141174676 16:81711001-81711023 GGTGGGGTGGGGAGGGCAGTCGG - Exonic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141513943 16:84530600-84530622 GAGAGGATGGGCAGGTCAGAGGG - Intronic
1141638897 16:85329840-85329862 GAATGTGTGGGGAGGGCGGAGGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141895894 16:86958671-86958693 GAGTTGGTGAGGAGGGGAGGTGG - Intergenic
1141900379 16:86986937-86986959 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141900389 16:86986953-86986975 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142184224 16:88686707-88686729 GAGTGGGTGGCCAGGCCCGACGG - Intergenic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142669711 17:1482598-1482620 GGCGGGGTGGGGAGGGCAGGGGG - Intronic
1142677102 17:1520638-1520660 GGGTGGGTGGGGAAGGGAGTGGG + Intronic
1142715642 17:1745519-1745541 GAGAGGGTGGGGAGGACCGAAGG + Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142769443 17:2086032-2086054 GACGGGGTGCGGAGGGCACAAGG + Intronic
1142836844 17:2593840-2593862 GAGGGGGAGGGGAGGGGAGCGGG - Exonic
1142977942 17:3656380-3656402 GGGTGGAGGGGCAGGGCAGAGGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143165433 17:4895078-4895100 TAGTGGGTGGAGAGGGCACTCGG + Exonic
1143309006 17:5972892-5972914 GATGGGGTTGGGAGGGTAGAGGG - Intronic
1143495823 17:7312173-7312195 GGATGAGTGGGGAGGGCACAAGG - Exonic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143775133 17:9194437-9194459 GAGTGAGTGGTGGGGTCAGAGGG + Intronic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144534807 17:16077574-16077596 GAGGGGAGGGGGAGGGGAGAAGG + Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144829751 17:18124564-18124586 GAGTGAGTGGGCAGGGCCGGCGG + Exonic
1144889622 17:18487087-18487109 GGGAGGGTGAGGAGGACAGATGG + Intronic
1145007131 17:19344295-19344317 GAGTCTGTGGGGTGGGCAGAAGG + Intronic
1145014338 17:19386966-19386988 GGGTGGGGGGGCAGGGAAGAGGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145142589 17:20457209-20457231 GGGAGGGTGAGGAGGACAGATGG - Intronic
1145772952 17:27506664-27506686 GAGGGGGTGGGAGGGGGAGATGG - Intronic
1146001138 17:29131221-29131243 GAGTAGGTGGGGATTGCAGGGGG - Intronic
1146285484 17:31571645-31571667 GACTGGCTGGGGTGGACAGAAGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146631290 17:34471677-34471699 GGGTGGGTGGGGAGGAGGGAGGG - Intergenic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146650724 17:34604575-34604597 GAGTTGGGGGAGGGGGCAGAGGG - Intronic
1146753912 17:35409173-35409195 GAGTGGTAGGGGAGGGCACTGGG - Intergenic
1146936187 17:36814023-36814045 GAGGGGGTGGACAGGGTAGAGGG - Intergenic
1147002482 17:37373896-37373918 GAGGAGGTGGTTAGGGCAGAGGG - Intronic
1147178578 17:38671585-38671607 GAGGGGGAGGGGAGGTCAGCAGG + Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147498917 17:40943443-40943465 GGGCGGGTGGGGAGAGCAGTAGG - Intergenic
1147579138 17:41618695-41618717 GAGTGGGGGGGCACTGCAGATGG - Intergenic
1147583393 17:41639045-41639067 AAGAGGGAGGGAAGGGCAGAGGG - Intergenic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147656042 17:42091637-42091659 GTGGGGGTGGAGAGGCCAGAGGG - Intergenic
1147772964 17:42880172-42880194 GAGGGGGTGGAGAGGGAATAGGG + Intergenic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147916472 17:43890512-43890534 GGGTTGGAGTGGAGGGCAGAGGG - Intronic
1148127800 17:45245819-45245841 TAGGGGGTGGGTAGGGCAGTAGG + Intronic
1148178136 17:45585045-45585067 GGCCGGGTGGGGAGGCCAGAGGG + Intergenic
1148331181 17:46814816-46814838 GAGTGGGTGGGAGAGGCAGCAGG + Intronic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1148562677 17:48614761-48614783 GAGGGGGTGGGGAGGGGGAAAGG + Exonic
1148754493 17:49965605-49965627 GAGTTGGGGGGGAGGGGATACGG - Intergenic
1148795583 17:50195192-50195214 CAGTGCATGGGGTGGGCAGAAGG + Intronic
1148855064 17:50574557-50574579 GTGGGGGTGGGGGGGGCACATGG - Intronic
1148866145 17:50629722-50629744 GAGTGGATGGTGGGGGCAGCAGG + Intergenic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1149646542 17:58245500-58245522 GACAGGGTGGGGAGGGGTGAAGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150007744 17:61480065-61480087 GAAGGGGTGGGGAGGACAGGAGG - Intronic
1150170422 17:62987789-62987811 TGGTGGGTGGGAAGTGCAGAGGG + Intergenic
1150221834 17:63500030-63500052 TAGAGGGTGGGGAGGGCTGTGGG - Intronic
1150255257 17:63739564-63739586 TAATGGAAGGGGAGGGCAGATGG + Intronic
1150326878 17:64264372-64264394 TGGTGGGTGGGAAGTGCAGAGGG - Intergenic
1150408033 17:64919335-64919357 GGCCGGGTGGGGAGGCCAGAGGG + Intronic
1150410473 17:64937250-64937272 GAGTGGTGGGGGTGGGGAGAAGG + Intergenic
1150624800 17:66835054-66835076 GAGAGGGAGGGGCGGGCAGGGGG - Intergenic
1150754218 17:67896385-67896407 GAGAGGGTGGGAGGGGCACAAGG + Intronic
1150793051 17:68215021-68215043 GAGAGGCCGAGGAGGGCAGATGG - Intergenic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1150984859 17:70184552-70184574 GGGAGGGAGGGGAGGGGAGAGGG - Intergenic
1151167044 17:72213075-72213097 TAGTGGGTGGGGTGGGGAGTAGG - Intergenic
1151197914 17:72445253-72445275 GGGTGGGTGGGGCGGGGAGGAGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151365378 17:73613344-73613366 GCGGGGGTGGGGAGAGCAGAGGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151391858 17:73792863-73792885 GAGGTGGAGGGGAGGGCTGAGGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151519585 17:74618625-74618647 GAGTGGGGAGGAAAGGCAGATGG - Intronic
1151599778 17:75099088-75099110 GAGTGGGTGGGGAGCGGGGAAGG + Intronic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1151666135 17:75546116-75546138 GAGGGGATGGGGAGGGGAGGCGG + Intronic
1151671604 17:75574274-75574296 GAGAGGGTGGGGCTGGCAGGAGG + Intronic
1151701058 17:75742775-75742797 GGGAGAGTGGGGAAGGCAGACGG + Intronic
1151886469 17:76925859-76925881 CAGGGAGTAGGGAGGGCAGAGGG + Intronic
1151969395 17:77450111-77450133 GTGAGGGTGGGGAGGGCCGTGGG + Intronic
1152075778 17:78158861-78158883 GGATGAGTGGGGAGGGCACAAGG - Intronic
1152141582 17:78540338-78540360 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152141702 17:78540770-78540792 GGGTGGGTGGGGTGGGTGGATGG + Intronic
1152217162 17:79040358-79040380 GAGAGGTTGAGGTGGGCAGATGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152234688 17:79132580-79132602 GAGTCGGGGGTGAGGACAGAGGG + Intronic
1152278808 17:79373223-79373245 GTAGGGGTGGGGAGGACAGAGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152374947 17:79914196-79914218 GGGTGGCAGGGGATGGCAGAGGG - Intergenic
1152410606 17:80120681-80120703 GAGGAGGTGAGGAGGGGAGAGGG - Intergenic
1152461523 17:80444650-80444672 GAGGGAGTGGGGAGGGCTGCAGG + Intergenic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152501222 17:80710365-80710387 GACTGGGTGGGGAGCGGGGAGGG + Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1152744357 17:82032101-82032123 GAGAGGGTGGGGCCGGCTGAGGG - Intronic
1152783146 17:82235319-82235341 GAGTGGGTGGGGTGGGGAAGTGG - Exonic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152851624 17:82639874-82639896 GTGTGGGTCGGGAGGGCTGCTGG + Intronic
1152863404 17:82709076-82709098 GGGTGGGTGGTAAGGGGAGAGGG - Intergenic
1153586056 18:6621873-6621895 GGAAGGATGGGGAGGGCAGAAGG - Intergenic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154297331 18:13162272-13162294 GAGGCAGTGGGGAGGGCTGAGGG + Intergenic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154380900 18:13848964-13848986 GAGGGCGTGGAGAGGGCCGAAGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154980230 18:21497796-21497818 GGGGGGGTGGTGAGGGGAGAAGG - Intronic
1155069376 18:22300488-22300510 GATTGGGTGGGGTGGGGGGAGGG - Intergenic
1155074593 18:22343539-22343561 AGGTGGATGGGGAGAGCAGAGGG - Intergenic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155243423 18:23884887-23884909 GAGGGGGCGGGGAGGGCTGTGGG + Intronic
1155537312 18:26830784-26830806 GAGTGGAGGAGTAGGGCAGAAGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1155707675 18:28837156-28837178 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1156104865 18:33647860-33647882 GAGTGGGGGAGTAGGGGAGAGGG + Intronic
1156195314 18:34768167-34768189 GAATTGGAGGGGAAGGCAGAGGG + Intronic
1156276548 18:35589071-35589093 AGGTTGGTGGGGAGGGCACATGG + Intronic
1156346186 18:36259076-36259098 GTGGGGGTGGGGGGTGCAGAGGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156449830 18:37260822-37260844 GAAGGGCTGGGGTGGGCAGAGGG - Intronic
1156469305 18:37367454-37367476 GTGGGGATGGGGAGGACAGAGGG + Intronic
1156514936 18:37671394-37671416 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1156772203 18:40742152-40742174 GAGAGGGGAGGAAGGGCAGAGGG + Intergenic
1157116182 18:44864683-44864705 GAGAGGGTGCGGGGTGCAGAGGG - Intronic
1157181863 18:45505428-45505450 GAGTGGGTGAGGAGCCCACAGGG + Intronic
1157531322 18:48423264-48423286 GAGTGGGTGGGGAAGGGAGGAGG - Intergenic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157721831 18:49931352-49931374 GTGGGGCTTGGGAGGGCAGAGGG - Intronic
1157733787 18:50028512-50028534 GAGTGGGGGGCAAGGACAGAAGG + Intronic
1157830207 18:50850579-50850601 GGGAGGCCGGGGAGGGCAGATGG + Intergenic
1157867309 18:51197544-51197566 GGGTGGGTGGGGACGGCGGCGGG + Intronic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1157944775 18:51967046-51967068 GAGTGAGGGGGGAGGGGGGAGGG - Intergenic
1158508746 18:58070707-58070729 GGGTGGGTGGGTAGGTGAGAGGG - Intronic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158811282 18:61039319-61039341 GAGTGGGAGGGTAAGGCAGAGGG - Intergenic
1158829573 18:61262910-61262932 GAGTGGATGGAGAGGACACAGGG - Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160122495 18:76143354-76143376 GAGTGGAGGGAGACGGCAGATGG + Intergenic
1160200170 18:76789162-76789184 GCGTGGCTGGGGAGGGAACACGG - Intergenic
1160409749 18:78667731-78667753 GAGAGGGGTGGGAGGGCGGATGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160575186 18:79849122-79849144 GACAGGGTGGGGCTGGCAGAGGG - Intergenic
1160659533 19:291591-291613 GAGGGGGAGGGAAGGGAAGAAGG + Intergenic
1160674916 19:384912-384934 GAGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160714610 19:570631-570653 GGGTGGGTGGGAGGGGCGGAGGG + Intergenic
1160714640 19:570684-570706 GGGTGGGTGGGGGGGGCGGAGGG + Intergenic
1160768705 19:821161-821183 GAGGGGGCGGGGAGGCCGGAGGG - Intronic
1160790141 19:919304-919326 GACTGGGAGAGGAGGGCAGGAGG - Intronic
1160931908 19:1574849-1574871 GAGTGTGTGCGGTGGTCAGAAGG + Intronic
1160939977 19:1615651-1615673 GTGAGGGTGGGGAGTGCCGAGGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161028821 19:2048724-2048746 GGGTGGGTGGGGAGGCAGGAGGG - Intronic
1161043330 19:2121594-2121616 GTGTGGTGGGGCAGGGCAGAGGG - Intronic
1161313482 19:3607333-3607355 GGGTGGGGTGGGAGGACAGAGGG + Intergenic
1161403802 19:4080937-4080959 GAGGGGATGGGGAGGGCAGGAGG + Intergenic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161548136 19:4894834-4894856 AAGTGGGAGGTGAGGTCAGAGGG - Intronic
1161636991 19:5395228-5395250 GGGACGGTGGGGAGGGAAGAGGG - Intergenic
1161719756 19:5896239-5896261 GGGAGGGTGGGGAGGGGACAGGG + Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161978659 19:7619551-7619573 GAGGGGGTGGGGAGGGGGGATGG + Exonic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1162560958 19:11418205-11418227 GAGGGGGAGGGGACGGGAGAGGG - Intronic
1162683059 19:12361678-12361700 GAGGGGGAGGGGGAGGCAGAGGG - Intronic
1162736135 19:12748143-12748165 GAGGGGGTGGGGAGGGTGGAGGG - Exonic
1162737783 19:12756048-12756070 GGGTGGGTGGGGACCACAGAGGG - Intronic
1162778918 19:12996511-12996533 GAGGGGCAGGGGAGGGGAGAGGG + Intronic
1162842006 19:13363591-13363613 GAGTGGGGAGGGAGGGCTCAGGG + Intronic
1162855596 19:13465999-13466021 AAGGTGGTGGGGAGGGGAGAAGG + Intronic
1162875286 19:13616841-13616863 GAGTGAGTGAGGGGGCCAGAAGG + Intronic
1162955055 19:14092828-14092850 AAGTGGGCTGGGAGGGCTGAGGG + Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1162992841 19:14314583-14314605 GAGCAGGAGGGGAGTGCAGAAGG + Intergenic
1163026299 19:14514657-14514679 GAGAGGGTGGGATGGGCAGGAGG - Intergenic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163491664 19:17620498-17620520 GGGTTGGTGGGTAGGGCAGAGGG - Intronic
1163563143 19:18032869-18032891 TGGGGGGTGGGGAGGTCAGAAGG - Intergenic
1163609672 19:18294399-18294421 GAGGGTGTGGGGAGGCCAGAGGG - Intergenic
1163680841 19:18681458-18681480 GAGTGGGTGGGGTTGAGAGAAGG + Intergenic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1163763707 19:19150794-19150816 GAGTGGGTGGAGAGTGGGGAGGG + Intronic
1163864894 19:19764828-19764850 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164648640 19:29876310-29876332 AAGGGGGTGTGCAGGGCAGAGGG + Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1164946162 19:32294932-32294954 GAGTGGAGGGGGTGGGCAGGAGG + Intergenic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165717617 19:38056474-38056496 GAGTGGGTGGCCAAGGAAGATGG - Intronic
1165787275 19:38469251-38469273 GGGCAGGTGGGCAGGGCAGAGGG - Intronic
1165834335 19:38745103-38745125 AAGAGGGTGGGGTGGGGAGAGGG - Intronic
1165928341 19:39341389-39341411 GAGGGGGTGGGGAAGAAAGAGGG - Intronic
1166139740 19:40799489-40799511 GAGTGGAGGGGGAGGGGAGGGGG + Intronic
1166343111 19:42150414-42150436 GAGGGGGTGGAGAGGGCTGGGGG + Intronic
1166583123 19:43920532-43920554 GGGTGGGGGGGGGGGGCAGTGGG + Intronic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1166646118 19:44533038-44533060 GAGGTGGTGGGGAGGGAAGCTGG - Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166765649 19:45251266-45251288 GAGGGGCTGGGGAGGGAGGAAGG - Exonic
1166781293 19:45344982-45345004 GGGTGGGAGGAGAGGGCCGAGGG - Intronic
1166888111 19:45973575-45973597 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1166960285 19:46492905-46492927 GAGGGGGAGGGGGGAGCAGAGGG - Exonic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1166996525 19:46722195-46722217 TAGTGGGTGGGGAGGGCCAGAGG - Intronic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167112353 19:47469797-47469819 GTGGGAGCGGGGAGGGCAGATGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167163447 19:47781978-47782000 GAGTTGGTGGTGGGGTCAGAGGG + Intronic
1167356090 19:49005185-49005207 GAGTGAGTGGGAAGAGCAGTGGG - Intronic
1167521674 19:49959313-49959335 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1167523709 19:49971409-49971431 GAGTCCATTGGGAGGGCAGAGGG + Intergenic
1167756358 19:51415851-51415873 GAGTCCATTGGGAGGGCAGAGGG - Intronic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167880193 19:52451293-52451315 GAGCGAGGGGCGAGGGCAGAGGG - Intronic
1168062428 19:53900386-53900408 GGGTGGGTGGGGACGTCAGAAGG - Intronic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168267330 19:55230019-55230041 GCGTGGGTGGGGGTGCCAGAGGG - Exonic
1168307418 19:55442981-55443003 GAGAGGCTGGGGAGGGCGGGCGG + Intergenic
925149580 2:1606033-1606055 GTGTGGGAGGGGACGGCCGAGGG + Intergenic
925210632 2:2042876-2042898 GAGCAGGGGGGAAGGGCAGAGGG - Intronic
925388494 2:3479896-3479918 GGGTGTGTGGGGAGGGCAAGAGG - Intronic
925418367 2:3690262-3690284 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
925418386 2:3690291-3690313 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
925418420 2:3690343-3690365 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
925571091 2:5313603-5313625 GAGAGGGTGGACAGGGCAAAGGG - Intergenic
926099205 2:10103307-10103329 GTGGGTGTGGGGAGGGCACAGGG + Intergenic
926121553 2:10243762-10243784 GAGTGGGGGGAGAGGCCAGGGGG - Intergenic
926223037 2:10948731-10948753 GAGTTGGTGGGGAGGACACCGGG + Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926394860 2:12430452-12430474 GAGAGGGAGGGAAGGACAGAAGG + Intergenic
926683547 2:15681088-15681110 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
926858741 2:17285273-17285295 GGGTGGGATGGGAAGGCAGAGGG + Intergenic
927121701 2:19970470-19970492 GATTGAATTGGGAGGGCAGAGGG - Intronic
927168725 2:20350829-20350851 GGGGGGGAGGGGAGGGCAGGCGG - Intronic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927477666 2:23426157-23426179 GAGGGGATGAGTAGGGCAGAGGG + Intronic
927516117 2:23672545-23672567 GGGTGGGTGGCCAGGGCTGAGGG - Intronic
927578518 2:24220606-24220628 GAGTGGATGGGAAGGGCCTATGG - Intronic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
927696463 2:25242728-25242750 GGCTGGGGGGGCAGGGCAGAGGG + Intronic
927800901 2:26098375-26098397 GAGAGGCTGAGGTGGGCAGATGG - Intronic
927900040 2:26812491-26812513 GAGGGGGTGGGAGGGGCAGTGGG - Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928716458 2:34066579-34066601 GAGTGAGTGGGAATGGTAGATGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929051670 2:37842260-37842282 AATGAGGTGGGGAGGGCAGAAGG + Intergenic
929204459 2:39275239-39275261 CACTGGGTGGGTAAGGCAGAAGG + Intronic
929453613 2:42051700-42051722 GAGGGGGTGGAGAGAGAAGAGGG + Intronic
929911262 2:46091241-46091263 AAGTGTATGGGGAGGGCAGGTGG - Intronic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
930745156 2:54875118-54875140 TGGAGGGTGGGAAGGGCAGATGG - Intronic
931094001 2:58919422-58919444 GATTGGGTTGGTAGGGGAGAAGG - Intergenic
931653536 2:64489663-64489685 GAAGGGGTGGGGAGGGAAAAAGG + Intergenic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932337504 2:70939292-70939314 GAGGGGGTGGGCCGGGCAGCTGG + Intronic
932358417 2:71085875-71085897 AAGTGGGTGGGGAGAACAGGAGG - Intergenic
932370656 2:71184760-71184782 AAGTGGGTGGGGAGAACAGGAGG - Exonic
932433053 2:71686831-71686853 GGGTGGGCGGGGAGGGTGGACGG + Intergenic
932488743 2:72104916-72104938 GAGTGAGGGGGCAGGGCAGGAGG + Intergenic
932689066 2:73897070-73897092 GTGAGGGTGGGGAAGGCAGGGGG - Exonic
932931185 2:76041448-76041470 GAGTGGGTGGGAGGGGGTGAGGG + Intergenic
933426260 2:82115692-82115714 GAGAGGGTGTGGTGGGCAGCAGG - Intergenic
933720136 2:85392471-85392493 GAGGGGGTCCGGAGGACAGAAGG - Intergenic
933891959 2:86780298-86780320 GGGTGGTTGGGGAGGGGATAAGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
934516747 2:94993251-94993273 GTGTGGGTGGGCCGGGCAAAGGG + Intergenic
934601755 2:95663445-95663467 GAGTTGGTGGGGGGGGGAGGTGG - Intergenic
934712746 2:96526625-96526647 GAGTGGGTGGGGTGGGCCCAGGG - Intergenic
934717867 2:96553683-96553705 GAGTGGGTGGCCAGGCCAAAAGG + Intergenic
934735369 2:96687283-96687305 GTGTTGGTGGAGAGGGCAAAGGG - Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
934941769 2:98507980-98508002 GGGTGGGTGGTGAGGGCATGGGG + Intronic
934992135 2:98929337-98929359 GAGTAGGTGCGGTGGGCACAGGG - Intronic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935150841 2:100433780-100433802 GAGTGTGTTGGGGAGGCAGAGGG - Intergenic
935211445 2:100942357-100942379 GGTGGGGTGGGAAGGGCAGAGGG - Intronic
935217211 2:100983648-100983670 GAGGAGGTGGGGAGAGCAGCAGG - Intronic
935294346 2:101635854-101635876 GAACTGGTGGGGAGGGGAGATGG - Intergenic
935308405 2:101759654-101759676 GAGGGGGAGGGGAGGGGGGATGG - Intronic
935327363 2:101948949-101948971 GAGTGGGTGGGAAGGGCATTGGG - Intergenic
935488960 2:103694014-103694036 GGGTGGGAGGGGAGAGCATAAGG - Intergenic
935814314 2:106832331-106832353 GAATCGGTGGGCAGGGCAGCCGG - Intronic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936086591 2:109473715-109473737 GAGTGGGTGGGGTGGGTGGGTGG - Intronic
936315712 2:111422558-111422580 GAGTTGGTGGCGAGGGCTGGAGG + Intergenic
936376553 2:111946090-111946112 GAGTGAGTGGGGAAGACAGAGGG + Intronic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
936895330 2:117421246-117421268 GAGGGGGTGGGGAAAGAAGAAGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937080292 2:119135659-119135681 GAGGGGGTGGGAAGGGCAAGGGG - Intergenic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937274974 2:120678557-120678579 GAGTTGGTCGGGGGTGCAGATGG + Intergenic
937335244 2:121058521-121058543 GAGTGTATGTGGAGGGCAAATGG + Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
937810036 2:126189029-126189051 GAGTGGCAGGGTAGCGCAGAAGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938052743 2:128190234-128190256 GAGAAGGTGGGGAGGGCACAAGG - Exonic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938701650 2:133885158-133885180 GAGTGGGTGATGAGGACACACGG + Intergenic
938727446 2:134120651-134120673 GAGCGGCGGGGGATGGCAGATGG + Intronic
938792144 2:134686141-134686163 GCTGGGGTGGGGAGGGCAGCTGG - Intronic
939436216 2:142181062-142181084 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
939606603 2:144262633-144262655 GAGGGAGAGGGGAGGGGAGATGG + Intronic
939618394 2:144386919-144386941 GAGGGGGTGGGGGGGGCAGGGGG - Intergenic
939671353 2:145016498-145016520 AAGTGGGGGGGGCGGGCACAGGG - Intergenic
940058070 2:149534475-149534497 GAGAGGGAGGGCAGGGGAGAAGG - Intergenic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940699810 2:157026682-157026704 GGGTGGGTGGGAAGTGTAGATGG + Intergenic
940762368 2:157751605-157751627 GAGGGGGTGGGGAGCACAGTGGG + Intronic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
940884935 2:158981110-158981132 GAGGGGGTCGGAAGTGCAGAGGG - Intronic
941034240 2:160549994-160550016 GAGTGAGTGGGGGGGGTATAAGG + Intergenic
941125205 2:161576324-161576346 AGGTGGATGGGGAGGCCAGAAGG - Intronic
941195373 2:162444184-162444206 GAGGGGTAGGGGATGGCAGAGGG - Intronic
942100509 2:172577715-172577737 GGATGGGTGGGGAGGGGAAAAGG - Intronic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
943751737 2:191516343-191516365 GAGCGGGTGGGGAGAGAAGGAGG + Intergenic
944053304 2:195496000-195496022 GAGTGAGTGGGGTGGGGAGGTGG - Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945662975 2:212709140-212709162 GAGAGGATGTGGAGGACAGAGGG - Intergenic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
946010521 2:216560204-216560226 GAGGGGAGGGGGAGGACAGAGGG - Intronic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946040742 2:216781167-216781189 GAGAGGGAGGGGAGGGGAGGGGG - Intergenic
946074923 2:217065828-217065850 GAGGAGGCTGGGAGGGCAGATGG - Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946310186 2:218878964-218878986 GGGAGAGTGGGGAGGGCAGGGGG + Intergenic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946387956 2:219397200-219397222 GGGTGGGAGGGGAGGGGAGGGGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946452100 2:219789082-219789104 GAGAGAGTGGGGAGGGAAGGAGG - Intergenic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946716207 2:222556887-222556909 GAGTGGATGGGGAGGAGTGAGGG - Intronic
947610802 2:231524032-231524054 GAGAGGCTGGGGAGGGCATGGGG + Exonic
947665118 2:231900620-231900642 GAATGGGCGTGGACGGCAGAAGG - Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
947859213 2:233347129-233347151 GAGTGGGAGGGTTGGGGAGAGGG + Intergenic
947871660 2:233442029-233442051 GAGAGGGTGCGGAGGTTAGAGGG + Intronic
947927658 2:233935769-233935791 AAGTGGGTGGGGCAGGCAGAAGG + Intronic
947996383 2:234531343-234531365 GCTTGGGTGGGGAGGGCAAGTGG + Intergenic
948201941 2:236135905-236135927 GAGGGGGCTGGGAGGGCAGCAGG - Intergenic
948504060 2:238415916-238415938 TCATGGGTGGGGAGGGTAGAGGG + Intergenic
948542330 2:238699531-238699553 GAGTGGGCGGTGAGGGGAGAGGG + Intergenic
948570926 2:238916735-238916757 GGGTGGGTGGGCAAGGCAGTGGG - Intergenic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
1169002376 20:2177373-2177395 GAGTGGGGCAGGAGGGCACAGGG - Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169066425 20:2696685-2696707 GTGCGGGTGCTGAGGGCAGAGGG - Intronic
1169066606 20:2697568-2697590 AAGGGGGTAGGGAGAGCAGAGGG + Intronic
1169091294 20:2862749-2862771 GAGGGGGTGGGATGGGCAGCAGG + Intronic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1169208461 20:3752905-3752927 GGGTGGATGGGGAGGCCAGAGGG + Exonic
1169235625 20:3927719-3927741 GCCTGGGAGGGAAGGGCAGATGG + Intronic
1169297013 20:4408731-4408753 GAGTGGGTTGTGAGGCTAGAAGG - Intergenic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169874663 20:10283908-10283930 GAGTTGGTGGTCAGGACAGAAGG - Intronic
1170220365 20:13935620-13935642 GAGTGAGTGGGGTGGGGAGAGGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170594078 20:17792464-17792486 GAGGGGGCAGGGAGGCCAGAGGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171249863 20:23638723-23638745 GAGGGGGTGGAGTGGGTAGAAGG - Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172762008 20:37329518-37329540 GCCTGGCTGGGGAGGGCAGGGGG - Intergenic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172870899 20:38134981-38135003 GAGAGGAAGGGGAGGACAGAAGG - Intronic
1172888926 20:38249875-38249897 GAGGGAGTGGGGAGGGCACCTGG - Intronic
1172995141 20:39064834-39064856 GAGGGGGTGGGGAGGCCAGGTGG - Intergenic
1173038481 20:39436023-39436045 AAGTGGGGGGTGAGGGGAGAGGG - Intergenic
1173058118 20:39635900-39635922 GAGTGGGTGGGGGGGGTCCATGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173136989 20:40447385-40447407 GATTGTGTGGGCAGGGGAGAGGG - Intergenic
1173384080 20:42572381-42572403 TGGTGGGTGGTGAGGCCAGAGGG - Intronic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1173661152 20:44734668-44734690 GAGGGGGTTGAGAGGGTAGAGGG - Intergenic
1173716514 20:45211573-45211595 GAGTGGGAGGGAAGGGAGGAGGG + Intergenic
1173719010 20:45237042-45237064 GAGTGGGGGTGGGGGGCGGATGG - Intergenic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1173823399 20:46032315-46032337 GAGGGGGTGTGAAAGGCAGAGGG + Intronic
1173825928 20:46047597-46047619 GGGTGGCTGGGGAAGGCTGAAGG + Intronic
1173826880 20:46053476-46053498 GAGTGGGTGGGAAGAGGGGAAGG + Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174161277 20:48552448-48552470 GAGGATGTGGGTAGGGCAGAAGG - Intergenic
1174216681 20:48921557-48921579 GAGAAGGTGGGGAGGGGAGTGGG - Intergenic
1174298963 20:49568345-49568367 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
1174306479 20:49617437-49617459 GAGAGGGTGGGGTGAGGAGAGGG - Intergenic
1174306485 20:49617453-49617475 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306499 20:49617503-49617525 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306523 20:49617586-49617608 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306533 20:49617619-49617641 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306543 20:49617652-49617674 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306549 20:49617668-49617690 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306559 20:49617701-49617723 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174306569 20:49617734-49617756 GAGAGGGTGGGGTGTGGAGAGGG - Intergenic
1174575947 20:51537247-51537269 GTGTGGGTGGGGGGTGCAGGGGG + Intronic
1174655220 20:52166253-52166275 GGCAGGGTGGGCAGGGCAGATGG + Intronic
1174698460 20:52583706-52583728 GAGTGGGTGGTGATGGCTGGAGG + Intergenic
1174804492 20:53593862-53593884 GAGGGGGCGGGGAGGGCGGAGGG + Intronic
1174873727 20:54206511-54206533 GGTTCGGTGGGGAGGGCACAGGG + Intergenic
1175108878 20:56631735-56631757 GAGTGCGGGGTGGGGGCAGAAGG - Intronic
1175224899 20:57439276-57439298 GGGTGGGAGGGCAGGGCAGGGGG - Intergenic
1175224932 20:57439342-57439364 GAGTGGGGTGGCACGGCAGAGGG - Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175392478 20:58636000-58636022 GAGAGGGAGGGGAGGGAGGAAGG + Intergenic
1175429254 20:58890956-58890978 GAGGGGCTGGGGTGGGCGGAAGG - Intronic
1175737826 20:61399570-61399592 GAGGCTTTGGGGAGGGCAGAGGG - Intronic
1175748077 20:61475522-61475544 GAGAGGGAGGGGCGGGCAGGGGG - Intronic
1175748098 20:61475575-61475597 GAGAGGGAGGGGCGGGCAGGGGG - Intronic
1175772497 20:61632593-61632615 GAGTGGGTGGAGTGGGTGGAGGG - Intronic
1175852377 20:62100440-62100462 GAGTGAGCGGGGAGGGCAGTCGG - Intergenic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175902558 20:62365893-62365915 AAGGGGGTGGGGCAGGCAGAGGG + Intronic
1176057093 20:63154700-63154722 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176057110 20:63154752-63154774 GAGGGAGGAGGGAGGGCAGAGGG - Intergenic
1176125522 20:63472965-63472987 GAGTGGAGGGGGAGGGGAGGGGG + Intergenic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176283238 20:64327398-64327420 GAGTGAGCGGGGAGGGGAGATGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176715612 21:10346862-10346884 GAGTGGGTGGGGAGGGCAAGAGG - Intergenic
1176733491 21:10521916-10521938 GAGGGGACGGGGAGGGCGGAGGG - Intronic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1177649250 21:23939447-23939469 GAGTTGGTGGGGTGGGAGGAAGG - Intergenic
1177844047 21:26268095-26268117 AGGTGGATGGGGAGGGCAAAAGG + Intergenic
1178150572 21:29789489-29789511 GGGGGAGTGGGGAGAGCAGATGG - Intronic
1178477540 21:32950479-32950501 CATTGGGTGGGGCGGGCAGAGGG + Intergenic
1178518554 21:33268112-33268134 GAGGGGGTAGGGTGGGCACATGG - Intronic
1178536049 21:33411312-33411334 GGGTGGGTGGCGAGGGGACAAGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178878231 21:36428889-36428911 GAGTGTGTGCTGAGGACAGACGG + Intergenic
1178964188 21:37100104-37100126 GAGTGGCTGGGGAGAGAAGGAGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179135829 21:38678930-38678952 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1179177784 21:39021508-39021530 GGGTGGGTGGGCAGGGCTGGTGG + Intergenic
1179428194 21:41298938-41298960 GAGTGGGGAGGGAAGGCAGGGGG + Intergenic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179714397 21:43280112-43280134 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714521 21:43280388-43280410 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714598 21:43280566-43280588 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179925922 21:44533970-44533992 GGGTGCGGGGGCAGGGCAGATGG + Intronic
1180035554 21:45246350-45246372 GAGGGTGTGGGAGGGGCAGACGG + Intergenic
1180076928 21:45467756-45467778 GAGTGGGCGGGCAGGGCACAGGG + Intronic
1180143814 21:45908914-45908936 GACTGGGTGTGGAGGGCACGGGG - Intronic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180170313 21:46055016-46055038 GAGGGGCTGTGCAGGGCAGAGGG - Intergenic
1180313994 22:11261958-11261980 GGGTGGGTGGGGTGGGGTGAGGG - Intergenic
1180569568 22:16702511-16702533 GAGTGGGTTGTGAGGACAGATGG - Intergenic
1180602735 22:17033091-17033113 GAGTGGGTGGGGAGGGCCAGAGG + Intergenic
1180699336 22:17773261-17773283 AAGGGTGTGGGGAGCGCAGAGGG - Intronic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1180996979 22:19970579-19970601 GAGTGGGGTGGGGGGGCAGGAGG + Exonic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181528028 22:23501266-23501288 GGGTGGGTGGGGTGGGCACCAGG + Intergenic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181731432 22:24849753-24849775 GAATGGGTGGGGAGGGAACCCGG + Intronic
1181977230 22:26738528-26738550 GAGGGGGAGGGGAGGGGAGGTGG - Intergenic
1181987557 22:26811047-26811069 GAGAGGGTGGCGGGGGCAGGAGG - Intergenic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182096706 22:27630660-27630682 GGGTGGGGGGTGGGGGCAGAGGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182305140 22:29362759-29362781 GAGTAGGTGGGAAAGGCAGCAGG - Intronic
1182312450 22:29418913-29418935 GAGTAGGTGGGAAAGGCAGCAGG - Intronic
1182679833 22:32070224-32070246 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
1182679843 22:32070240-32070262 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1182687814 22:32134351-32134373 GAGTAGGTGGGAAAGGCAGCAGG + Intergenic
1182960671 22:34471637-34471659 GAGTGGGGGGTGCTGGCAGAAGG + Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183058987 22:35323854-35323876 GTATGGGCGGGGCGGGCAGAGGG - Exonic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183203073 22:36399484-36399506 GAGTGGATGGTGAGGTCTGATGG - Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1183535517 22:38398544-38398566 GAGGGGGCGGGGAGGGCGGAGGG + Intergenic
1183551027 22:38485531-38485553 GAGTTGGTGGGGAGGGAGGGAGG - Exonic
1183580965 22:38726497-38726519 GAGTGGGTGAGCAGGGCATCTGG - Intronic
1183708478 22:39489052-39489074 GAGTGGGTGGGGAGTGGGGGTGG + Exonic
1183724851 22:39582808-39582830 GGGTGGGTGGGGAGTAAAGATGG - Intronic
1183858636 22:40653243-40653265 GAGGGGGAGGGCAGGGGAGAAGG + Intergenic
1183862386 22:40679467-40679489 AAGGGAGTGGGGAGGGCAGTTGG + Exonic
1184253161 22:43272271-43272293 GAGTGGGTGGGAAGGGGACCAGG - Intronic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184538149 22:45101525-45101547 GGGTGAGGGGGGAGGGGAGAAGG - Intergenic
1184555127 22:45228918-45228940 GAGTGGTTGGGGGGTGGAGAGGG - Intronic
1184611432 22:45606513-45606535 GACAGAGTGGGGAGGACAGAGGG - Intergenic
1184614594 22:45629618-45629640 GAGGGGGCGGGGACAGCAGAGGG - Intergenic
1184760415 22:46540653-46540675 AAGTAAGTGGGGAGGGGAGAGGG + Intergenic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1184933707 22:47702218-47702240 GAGGGGGAGGGGAGGGGGGAGGG - Intergenic
1185102571 22:48849575-48849597 GAGGGAGCTGGGAGGGCAGATGG + Intronic
1185207896 22:49550654-49550676 GAGTGTGAGGTGAGGACAGAGGG - Intronic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
949106885 3:210404-210426 GAGTGGCTGGGGTGGGCTGGTGG + Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949810408 3:8001133-8001155 GGGTGGGTGGGGCAGGCAAAGGG - Intergenic
949920870 3:8999531-8999553 TAGGGGGTGGGGTAGGCAGAGGG - Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950416350 3:12871013-12871035 GAGTGGAGGGGGAGGCCACAGGG - Intronic
950525190 3:13519110-13519132 GAGTCATTGGGGAGGGAAGAGGG - Intergenic
950556525 3:13699282-13699304 GGGTGCGTGGGGGAGGCAGAGGG + Intergenic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
950726779 3:14922020-14922042 GAGTGGGTGGGCAGGGCCCACGG + Intronic
950863575 3:16171483-16171505 GGGAGGGTGGGGAGGGCAAGAGG + Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951035802 3:17930621-17930643 GGGTGGGAGGTGAGGGTAGAGGG + Intronic
951088979 3:18549765-18549787 GAGTGGGTGGCGGGGGGCGAGGG + Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951345042 3:21537704-21537726 GAGTGAGTGAGGTGGGCAGTGGG + Intronic
951623165 3:24628970-24628992 GAGTGGTTGGGGAAGGCTGAGGG - Intergenic
952231123 3:31432150-31432172 GAGTGGGAGGGGAGTGCAGTGGG - Intergenic
952237536 3:31495587-31495609 GAGTGGCTTGGGAGAGCTGAGGG + Intergenic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952877597 3:37959962-37959984 GAGAGGCCGAGGAGGGCAGATGG + Intronic
953194341 3:40718186-40718208 GAGGAGATGGGGAGGGCAAAGGG + Intergenic
953224100 3:41000522-41000544 GAGTGGGTGAGCAGGATAGACGG + Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954051689 3:47984590-47984612 GGGAGGGTGGGGAGAGCAGATGG + Intronic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954405858 3:50344788-50344810 GAGGGGTTGGGGAGGGCGGGAGG - Intronic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954444807 3:50540900-50540922 GGGAGGGTGGGGTGGGCGGATGG - Intergenic
954463274 3:50639791-50639813 GAAAGGCTGGGGAGGGGAGAGGG - Intronic
954578246 3:51688654-51688676 GATTGGCTGGGGAGTGCAGGTGG + Intronic
954635400 3:52068331-52068353 AAGGGGCTGGGGAGGGGAGAGGG + Intergenic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955072879 3:55586149-55586171 GAGGGAGTGGGGACTGCAGAGGG + Intronic
955349293 3:58182173-58182195 GAGGGGGAGGGGAGGGGAGGAGG + Intergenic
955592371 3:60551536-60551558 GGGGGGGAGGGGAGGGGAGACGG + Intronic
955751147 3:62186435-62186457 GGGTAGGTGGTGAGGACAGAGGG + Intronic
955848294 3:63192292-63192314 GGGTGGGTGGGGGAGGGAGATGG - Intergenic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
956262672 3:67362178-67362200 GAGTGGGTGTGGAGAGCAACAGG - Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
956758235 3:72411718-72411740 GAGTGGGGAGGGAGGGCATTTGG - Intronic
956856481 3:73280173-73280195 GAGTGGGAGGGGAATGAAGATGG + Intergenic
956976509 3:74587165-74587187 GGGTGGGAGGTGGGGGCAGAAGG + Intergenic
957619947 3:82583839-82583861 GAGGGGGAGGGGGGGGGAGAGGG - Intergenic
958182869 3:90083186-90083208 GAGTGGGTGGGGGTGTCACAAGG - Intergenic
958575424 3:95944243-95944265 GGGAGGCTGGGGAGGGCAAAGGG - Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959156643 3:102674497-102674519 CAGTGGCTGGGGCGGGCAGAAGG - Intergenic
960108149 3:113819959-113819981 GTGTGGGTGGGGAAAACAGAGGG - Intergenic
960159813 3:114338404-114338426 GTGGGGGTGGGAAGGGCAGTGGG - Intronic
960204978 3:114886066-114886088 GAGTGGGTAGAGGGAGCAGAAGG - Intronic
960288955 3:115861073-115861095 GAGAGGGAGGGGAGGAAAGAGGG - Intronic
960373013 3:116864133-116864155 GAGGGAGTGGCGGGGGCAGAAGG - Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960604296 3:119489241-119489263 GATTGGGTGGGTGGGGCATATGG - Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
961063129 3:123849884-123849906 TAGGGTGTGGGGAGGGGAGAGGG - Intronic
961075617 3:123979301-123979323 GAGTGGGTGTCCTGGGCAGATGG - Intronic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
961308068 3:125973207-125973229 GAGTGGGTGTCCTGGGCAGATGG + Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
961940861 3:130636754-130636776 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940876 3:130636782-130636804 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
962203278 3:133416696-133416718 GAGAGGATGGGGAGAGTAGAGGG - Intronic
962203462 3:133417404-133417426 GAGAGGGTGGGGTGAGTAGAGGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962613391 3:137100698-137100720 GAGAGGGTGGGGGTGGGAGAGGG + Intergenic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
963115601 3:141726462-141726484 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
963729571 3:148958309-148958331 GTGTGGCTGGGCAGGGGAGATGG - Intergenic
964002832 3:151796186-151796208 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
964213374 3:154252698-154252720 GAGTGTGTGGGAAGGGAAGTGGG + Intronic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964492669 3:157253449-157253471 GAGTGAGTGGAATGGGCAGAGGG - Intergenic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
965882121 3:173398211-173398233 GAGGGCCTGGGGAGAGCAGAAGG - Intronic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966295862 3:178422132-178422154 GAGGGGGAGGGAAGGGGAGAGGG - Intronic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966989277 3:185212429-185212451 GAGTGGGAAGGGAGTGTAGAAGG - Intronic
967751354 3:193119705-193119727 TAGTGGGTGGGAAGGGCTGTTGG - Intergenic
967937015 3:194737145-194737167 GGCAGGGTGGGGAGGGAAGAGGG - Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968077359 3:195823879-195823901 GAAGAGGTGGGGAGGGCAGGAGG + Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968452745 4:682914-682936 GAGGGGGTGGGCAGTGCAGCGGG - Intronic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968512205 4:1000735-1000757 GAGAGGGTGGGCAGGGCAAGGGG - Intronic
968534469 4:1114116-1114138 GTGGGGGTGGGGGGGGCAGTTGG + Intergenic
968547124 4:1205144-1205166 GAGGGCGTGGCGAGGGCACAGGG - Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968616159 4:1578803-1578825 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616166 4:1578821-1578843 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616173 4:1578839-1578861 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616180 4:1578857-1578879 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616187 4:1578875-1578897 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616194 4:1578893-1578915 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968616201 4:1578911-1578933 GAGGGGGAGGGGAGAGAAGAGGG + Intergenic
968637021 4:1685676-1685698 GCGGGGCTGGGGAGGGGAGAAGG + Intergenic
968684151 4:1945223-1945245 GACGGGGTGGGGTGGGGAGATGG + Intronic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
968887322 4:3341593-3341615 GAGGGTGTGGGGAGGGGACAAGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968887381 4:3341738-3341760 GAGGGTGTGGGGAGGGGACAAGG + Intronic
968909292 4:3469419-3469441 GGGTGGGTGGGCAGGGCTGATGG + Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968924686 4:3541028-3541050 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
968925673 4:3546209-3546231 GAGAGGCTGAGGCGGGCAGATGG + Intergenic
969240587 4:5894456-5894478 GACTGGGTGGGGACTGCAGAGGG + Intergenic
969370429 4:6727866-6727888 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
969456696 4:7304346-7304368 AAGAGGGAGGGAAGGGCAGAAGG - Intronic
969477740 4:7431078-7431100 GAGTGAGTGGAGGGGTCAGAGGG + Intronic
969490509 4:7496823-7496845 GAGCGGCTGGGGAAGGCACAGGG + Intronic
969533586 4:7742252-7742274 GTGTGGGTGGGGTGGCCAGCAGG - Exonic
969657154 4:8504968-8504990 GGGAGGGTGGGTAGAGCAGAAGG - Intergenic
969722049 4:8897584-8897606 GAGAAGGTGGGAAGGACAGAGGG - Intergenic
969841516 4:9886494-9886516 GAATGGTTGGGGAGGGCATCAGG - Intronic
970637148 4:18021883-18021905 GAGGGGGAGGGCAGGGCAGAGGG - Intergenic
971325048 4:25636760-25636782 GATGGGGAGGGGAGGGCAGCAGG - Intergenic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
972614198 4:40682644-40682666 GCGTGGGAGGGGAGGACACACGG - Intergenic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
973646022 4:52952214-52952236 GAGGGGATGGGGAGGTGAGAGGG - Intronic
973779135 4:54271964-54271986 GAGGGGGAGGGGAGGGGGGAGGG - Intronic
974540737 4:63230922-63230944 GAGAGGATGGGGAGGGACGAGGG + Intergenic
974739536 4:65987456-65987478 GGGTGGGTGGGGGGAGGAGAGGG + Intergenic
974758354 4:66242823-66242845 GGGTGGGCGGGGAGGGGGGAGGG - Intergenic
974833400 4:67216435-67216457 GAGGGGGAGGGGAGGGGGGAGGG + Intergenic
974849266 4:67385610-67385632 GAGGGGGAGGGGAGGGGGGAAGG + Intergenic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
976556972 4:86461316-86461338 AAGTGGATGGGGAAGGCACAGGG + Intronic
976675231 4:87695399-87695421 GGGAGGGAGGGGAGGGGAGATGG + Intergenic
976821621 4:89213439-89213461 GACTGGCTTGGGAAGGCAGATGG - Intergenic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977554740 4:98477291-98477313 GAGCTGGTGGGAAGGGCAGCTGG + Intronic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
977918380 4:102618153-102618175 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
977969656 4:103198551-103198573 GAGTCGGAGGAGAGGGCCGAAGG + Intergenic
978092776 4:104738303-104738325 GACTCGGTGGGGAGGGTAGTGGG + Intergenic
978100514 4:104834738-104834760 GAGGGGGTTGGGAGGTGAGATGG - Intergenic
978354431 4:107856572-107856594 GAGTGAGTGGGGATGGTAGGTGG + Intronic
978400191 4:108322884-108322906 GAGGGGGTGGGGAGGAGAAAGGG + Intergenic
978644723 4:110916102-110916124 GAGTGGGAGGAGAGGTCAGAGGG + Intergenic
979298021 4:119054671-119054693 GTGTGGGTGGGGTGGGCCGCAGG + Intronic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
980075299 4:128287824-128287846 GTGGGGTTGGGGAGGGCAGGGGG - Exonic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
980438303 4:132809546-132809568 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980546909 4:134276137-134276159 GAATGGGCTGGGAAGGCAGAGGG + Intergenic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982001592 4:151025812-151025834 GAGAGGCTGAGGTGGGCAGATGG + Intergenic
982481015 4:155909933-155909955 GAAAGGGGGGGGAGGGGAGAGGG - Intronic
982710688 4:158755949-158755971 GAGAGGAGGGGGAGGGAAGAGGG - Intergenic
984142129 4:176016305-176016327 GAGTTAGTGGGGAGGGAGGAAGG - Intergenic
984159127 4:176229916-176229938 GGGTGGGAGTGGAGAGCAGAAGG + Intronic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984983991 4:185309617-185309639 GACTGGCTGGGCAGGGTAGAGGG - Intronic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985462016 4:190116615-190116637 GGGTGGGGGGGGAGGGGGGAGGG - Intergenic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
985618719 5:940745-940767 GGGTGGGTGGGGAGAGCACTGGG - Intergenic
985658097 5:1142406-1142428 GAGAGAGTGAGGAGGGGAGAGGG - Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
986232744 5:5881605-5881627 GAGTGGGTGGGGAAGGCGACAGG + Intergenic
986311896 5:6557224-6557246 GGGTGGCTGGGGAGGACCGAAGG + Intergenic
986333182 5:6733169-6733191 GAGTAGGGGGTGAGGCCAGAGGG + Intronic
986541930 5:8853460-8853482 GAGAGGGTGGGGAGGACATGGGG + Intergenic
986680505 5:10228867-10228889 GAGAGGCTGAGGTGGGCAGATGG - Intronic
987249046 5:16080138-16080160 GAATGGCTGGGATGGGCAGAAGG - Intronic
987258537 5:16180409-16180431 GAGCGGGTGAGGAGGACACAGGG - Intronic
987764036 5:22202103-22202125 GAGAGGGAGGGAGGGGCAGAGGG - Intronic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
989102990 5:37837955-37837977 GAGGCGGTGGGGCGGGGAGACGG + Intronic
989440505 5:41466689-41466711 GAGTTGGTGGGGAGGAGTGAGGG - Intronic
989445399 5:41522705-41522727 GAGTGTGGGGGCAGGGGAGAAGG - Intergenic
989596080 5:43157425-43157447 GAATGGGTGGGTGGGACAGAAGG - Intronic
990208048 5:53451286-53451308 GGGTGGGGGGAGAGGGCAGCTGG - Intergenic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
990407233 5:55503809-55503831 GAAGGGGAGGGGAGGGAAGAGGG + Intronic
990480120 5:56202144-56202166 GAGGGGGTGGTGTGGGGAGAGGG + Intronic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
991898761 5:71435181-71435203 GAGAGGGAGGGAGGGGCAGAGGG - Intergenic
992015958 5:72575444-72575466 GGGTGGCTGGGGAGAGTAGAAGG - Intergenic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
992521129 5:77552668-77552690 GAGAGTGTGGTGTGGGCAGAGGG + Intronic
992526358 5:77614648-77614670 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
992703986 5:79369408-79369430 GGGAGGGTGGAGAGGGTAGAAGG + Intergenic
993064129 5:83077389-83077411 GAGAGGGCGAGAAGGGCAGACGG - Exonic
993469527 5:88289575-88289597 GAGGGGTTGGGGAGGCTAGATGG + Intergenic
993701851 5:91128081-91128103 GAGAGGGAGGGGAGGGCATTGGG - Intronic
994129539 5:96209645-96209667 GATTGGGTGGGGTGGGCGGGGGG - Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
995070261 5:107913155-107913177 GAGTTCATGGGGAGGGTAGAAGG + Intronic
995706880 5:114995972-114995994 GAGTGGTTGGCGATGGAAGAAGG + Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
997131255 5:131278725-131278747 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
997737955 5:136228283-136228305 GAGTGGGTGGGGTGGGGGGTAGG + Intronic
998028018 5:138837507-138837529 GAGAGGGAGGGGAGGGAGGAGGG - Intronic
998150967 5:139757226-139757248 GAGTGGGCTGGGTGGGCAGTGGG + Intergenic
998171472 5:139874358-139874380 AAGAAGGTGGGTAGGGCAGATGG - Intronic
998178152 5:139914758-139914780 TAGTGGGTGGGGCGGGCACCTGG - Intronic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998349044 5:141489062-141489084 GAGTGGCGGGGGTGGGCAGGGGG - Intronic
998383757 5:141744085-141744107 GAGGGAGTGGGGATGTCAGAGGG - Intergenic
998390777 5:141785815-141785837 GAATGAGTGGGGAGGGATGATGG - Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998894573 5:146785864-146785886 CAGTGGTTGGGAAGGGCATAGGG + Intronic
999143006 5:149375034-149375056 GTGGGGGTGGGGCAGGCAGAGGG - Intronic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999869172 5:155731339-155731361 GAATGGGTGGGGAAGTCAGATGG + Intergenic
1000185080 5:158851397-158851419 GAGGGGGAGGGGAGGGGAAAGGG + Intronic
1001131974 5:169071842-169071864 GGATGAGTGGGCAGGGCAGAGGG + Intronic
1001141341 5:169146536-169146558 AAGGGGGTGTGGAGGTCAGAAGG - Intronic
1002040840 5:176513017-176513039 GACAGGCAGGGGAGGGCAGAAGG - Intergenic
1002068535 5:176664886-176664908 GGGTGGGTGGGAGGGGCAGGAGG - Intergenic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002441113 5:179265065-179265087 GGGTGAGTGGGGTGGGCAGCGGG - Intronic
1002526691 5:179819311-179819333 GGGGGGGCGGGGAGGGGAGAAGG - Intronic
1002766968 6:249614-249636 GCTGGGGTGGGGAGGACAGAAGG - Intergenic
1002853283 6:1015598-1015620 GAGTGGGGGGTGAGGGGTGAGGG + Intergenic
1002869204 6:1150706-1150728 GAGTGCTTGGGGAGGGCAGAGGG - Intergenic
1003110366 6:3247930-3247952 GCGTGGGTGGGAGGGGCAGGTGG - Intronic
1003256682 6:4481276-4481298 GTGTGAGTGGGGAGAGCACAAGG - Intergenic
1003564931 6:7214805-7214827 GTGTTGGTGGGGAGTGGAGAAGG - Intronic
1003674744 6:8192797-8192819 GAGAAGGTGGGGAGGAGAGATGG + Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004391563 6:15214274-15214296 GGTGGGGTGGTGAGGGCAGATGG + Intergenic
1004811222 6:19265862-19265884 GAGGAGGTGGGGGGGGCAGTGGG + Intergenic
1004911614 6:20290947-20290969 GAGCGGGTGGGGAGGCAGGAGGG + Intergenic
1004924464 6:20403690-20403712 GGGGGGGTGGGGAGAGGAGAGGG - Intronic
1005134949 6:22557274-22557296 TAGTGGGTGGCGGGGGCAGGGGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005716380 6:28553345-28553367 GAGTTTGTGGGGAGGGGAGGAGG + Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006021209 6:31118656-31118678 GAGGGGCTAGGGAAGGCAGAAGG - Intronic
1006021567 6:31120818-31120840 GACTGCGAGTGGAGGGCAGATGG - Intronic
1006112939 6:31759759-31759781 GAGTGGGTGAGGAAGGGAGCTGG - Intronic
1006187874 6:32190830-32190852 GGGAGGGTGGGCAGGGCTGAAGG + Exonic
1006415559 6:33901767-33901789 GGGAGGGAGGTGAGGGCAGAAGG + Intergenic
1006641129 6:35490338-35490360 GAGGGGGAGGGGAGGGGGGACGG + Intronic
1006642569 6:35496685-35496707 GGGGGGGTGGGGAGGGCGGGGGG + Intronic
1006942686 6:37763353-37763375 GTGTGGGTGGTAAGGGAAGAGGG + Intergenic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007029650 6:38616526-38616548 GAGTGGGAGGTGAGGCCAGCTGG + Intronic
1007171698 6:39868700-39868722 GATTGGGTGGAGAGAGCAGATGG + Intronic
1007255276 6:40523981-40524003 GAGGGGCTGGGAAGGGCAGGGGG + Intronic
1007282111 6:40720440-40720462 GTGGGGGTGGGGAGGCCTGAGGG - Intergenic
1007406763 6:41639897-41639919 AAGTAGGTGGGGAGTGGAGAGGG - Intronic
1007760979 6:44133646-44133668 GAGTGGATGGGGTGGGCAGGAGG - Intronic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009223211 6:61001987-61002009 GGGTGGGGGGGGAGTGGAGAGGG + Intergenic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009593814 6:65708969-65708991 GAGGGGGGGGAGAGGACAGAAGG - Intergenic
1009745405 6:67807088-67807110 TAGTGGCTGGGAAGGGTAGAGGG + Intergenic
1009826701 6:68875236-68875258 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1010754909 6:79655944-79655966 GAGTGGGAGGGGAAGGTAGTTGG + Intronic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1010813541 6:80327912-80327934 GGGAGGGAGGGGAGGGGAGAAGG - Intronic
1011112972 6:83859127-83859149 GAGTGGGTGAATAGAGCAGAAGG + Intergenic
1011632339 6:89339551-89339573 GAAGGGATGGGGAGGGAAGAGGG + Intronic
1011704126 6:89984182-89984204 GAATGGATGTGGAGGGCAGTGGG - Intronic
1011755468 6:90494338-90494360 GAGAGTGTGAGGTGGGCAGAGGG - Intergenic
1012100795 6:95083846-95083868 GAGTGCGGGGGGAGGGGAGGAGG + Intergenic
1012312800 6:97749018-97749040 GAGTGGGGGGCAAGGGGAGAGGG - Intergenic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012425190 6:99106282-99106304 GAGTGGGTGGTAAGGGCAGGGGG + Intergenic
1012431481 6:99168311-99168333 GAAGGGGAGGGGAGGGAAGAAGG + Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1012967941 6:105695774-105695796 GGGTGGGTGGGGTGGGCTGCTGG - Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013167142 6:107604601-107604623 AAGGAGGTGGGGAGGGGAGATGG - Intronic
1013215828 6:108026396-108026418 AAGTGGGTGGAGAGTGAAGATGG + Intergenic
1013304279 6:108833559-108833581 GGGTGGGTGGGGGGTGCTGAGGG + Intergenic
1013986553 6:116200880-116200902 GAGTGGGTGGGGGAAGAAGAAGG - Intronic
1014325396 6:119986819-119986841 AGGTGGATGGGGAGGTCAGAAGG - Intergenic
1014513462 6:122353966-122353988 GGGGGGGTGGGGAGGGCAGGGGG + Intergenic
1014648366 6:124004432-124004454 GGGAGGGTGGGGAAGGAAGAGGG + Intronic
1014935478 6:127380469-127380491 GGGTGGGAGGGGTGGGCGGATGG - Intergenic
1015072237 6:129108551-129108573 GAATGGGTGGGGTGTGTAGAGGG - Intronic
1015181618 6:130366605-130366627 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1016330215 6:142946362-142946384 GAGTGCGCGGCGAGGGCGGACGG + Intergenic
1016830102 6:148425698-148425720 GAGGGGGATGGGAGGGGAGAAGG - Intronic
1016830110 6:148425716-148425738 GAGGGGGAGGGGAAGGGAGAGGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017340889 6:153320549-153320571 GAATGGGTGGTGAAGGAAGAGGG + Intergenic
1017359181 6:153545973-153545995 GGGGTGGTGGGGAGGGCAGAAGG - Intergenic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1017758806 6:157552407-157552429 GAGGAGGAGGGGAGGCCAGATGG + Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018027234 6:159816117-159816139 GGGTGGGTGGGGAGGGGTGTGGG - Intronic
1018199533 6:161382255-161382277 GATGTAGTGGGGAGGGCAGATGG + Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018369174 6:163151373-163151395 GTGTTGCTGGGGAGGGCAGGGGG - Intronic
1018710776 6:166496958-166496980 GAGTGGTGGGTGAGGGCAGCGGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018732156 6:166659379-166659401 GGGTGGCCGGGGAGGGGAGAGGG + Intronic
1019163859 6:170086685-170086707 GAGCAGGCGGGGAAGGCAGAAGG + Intergenic
1019329493 7:455614-455636 GCGTGGGGGCGGGGGGCAGAGGG - Intergenic
1019335732 7:481648-481670 GGGAGGGTGGGGAGGGGAGGAGG - Intergenic
1019422102 7:955196-955218 GAGTGGGAGGGGTGCCCAGAGGG - Intronic
1019455467 7:1124563-1124585 GGGTGGGGGGGGAGGGGGGAGGG + Intronic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019494907 7:1333325-1333347 GAGGAGGTGAGGAGGGAAGAGGG - Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019551788 7:1606800-1606822 GAGTGGGAGGGGAGGAGGGAGGG - Intergenic
1019706618 7:2500014-2500036 GGGTGGGTGGGGTGGCCAGGGGG - Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1019982246 7:4630155-4630177 GAGTGGGTGGGCAAGGCTGATGG - Intergenic
1020125928 7:5532463-5532485 GGGGGGGTGGGGTGGGCAGTGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021052837 7:16010663-16010685 GAGTAGGTCGTAAGGGCAGAAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021768124 7:23969690-23969712 GAGTGTGGGGGAAGGGCAGGGGG + Intergenic
1021866375 7:24962388-24962410 AGGGGGGAGGGGAGGGCAGAAGG + Intronic
1021868432 7:24980405-24980427 GGATGGGTTGGGAGGGCGGAGGG + Intronic
1021896682 7:25243196-25243218 GAGGGAGTGGGGAGAGCGGAAGG - Intergenic
1022090194 7:27103038-27103060 GAGTGTGCGGGGGAGGCAGAGGG - Intergenic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022514546 7:30966991-30967013 GAGGGGCTGGGGAAGGGAGAAGG - Intronic
1022520929 7:31006521-31006543 GAGAGGGTGGGGTGGAGAGAAGG - Intergenic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022692012 7:32665416-32665438 GATGGGGTGGGGAAGACAGATGG + Intergenic
1022801285 7:33779793-33779815 AAGTGGATGGGGAGGAGAGAAGG - Intergenic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023136371 7:37056735-37056757 GTGATGGTGGGGAGGGCAGGGGG + Intronic
1023156405 7:37256606-37256628 AAAGGGGAGGGGAGGGCAGAGGG + Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1023863084 7:44227043-44227065 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863110 7:44227117-44227139 GAGGGAGTGTGGAGGACAGAGGG + Intronic
1023863153 7:44227248-44227270 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1023863180 7:44227323-44227345 GAGGGGGTGTGGGGGACAGAAGG + Intronic
1024512176 7:50212885-50212907 GGGAGGGTGGGTAGGGCAGATGG + Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1024565222 7:50674950-50674972 GAGGGGGTGGGGAGGAGAGAAGG - Intronic
1024579977 7:50793448-50793470 GAGGGGGTGGGGAGGTCGGGAGG - Intronic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1024729505 7:52238812-52238834 GGAAGGGTGGGGAGGACAGAGGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026265868 7:68795618-68795640 TAATGGATGGGGAGAGCAGATGG + Intergenic
1026294838 7:69042222-69042244 GAGGGAGTTGGGAGGGCAGGAGG - Intergenic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1026368546 7:69674625-69674647 GGGTGGGTGGGTAGGGAATAAGG + Intronic
1026414432 7:70163343-70163365 GTGGGGGGGGGGGGGGCAGAGGG + Intronic
1026828302 7:73597116-73597138 CAGGGGGTGGGGAGGACAGGGGG - Intronic
1027269612 7:76512497-76512519 GAGGCAGCGGGGAGGGCAGAGGG - Intronic
1027320322 7:77006391-77006413 GAGGCAGCGGGGAGGGCAGAGGG - Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027443893 7:78249691-78249713 CAGTGGCTGGGGAGGGTAGTGGG + Intronic
1027605568 7:80294311-80294333 GAGGGAGTGGGGAGGGAGGAAGG - Intergenic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028297890 7:89158372-89158394 GAATGGGTGTGGAGGGCTAAGGG - Intronic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028684375 7:93575524-93575546 GAGAGGATGGCGAGGGAAGACGG + Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029514392 7:101016741-101016763 GAGTGGGTGGGAGAGGGAGAGGG + Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1029813139 7:103069140-103069162 CAGTGGGGCGGCAGGGCAGAGGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030058624 7:105605197-105605219 GAGTGGGTGTGCAGAACAGAAGG + Exonic
1030104188 7:105973055-105973077 GAGTGGGTAGGGACAGTAGAAGG - Intronic
1030218305 7:107069612-107069634 GAGTCGGAGGAGTGGGCAGATGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031077319 7:117225464-117225486 GACTGTGTGGGGAAGGAAGATGG + Intronic
1031219443 7:118945927-118945949 CAGTGGGTGGGAGAGGCAGAAGG - Intergenic
1031288750 7:119906752-119906774 TAGTAGCTGGGGAGGGTAGAGGG - Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032000025 7:128259210-128259232 GAGGAGGTGGGGAGAGAAGAGGG + Intergenic
1032058244 7:128701324-128701346 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1032425634 7:131820207-131820229 GAGTGGGAGGGGCAGGCAGAGGG - Intergenic
1032509226 7:132458846-132458868 GAGTGGATGGGCTTGGCAGAGGG - Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033227382 7:139572758-139572780 GGGGGGGGGGGGGGGGCAGAGGG - Exonic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033354926 7:140591951-140591973 GAGGGGGAGGGGAGGGGAGTAGG - Intronic
1033599656 7:142879829-142879851 GAGTGGGTGGGACGTGCAGAGGG - Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1033970616 7:147034684-147034706 AGGTGGATGGGGAGGTCAGAAGG + Intronic
1034008348 7:147499744-147499766 GAGTGGGTGGGGAGAAAAGGAGG + Intronic
1034263309 7:149770344-149770366 GAGGGAGGGGGGAGGGAAGAAGG + Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034427357 7:151021128-151021150 GAGAGGGTGGGCAGAGGAGAGGG - Intronic
1034475185 7:151277542-151277564 GAGGGGGTGGGGGGTGCACATGG - Intronic
1034662613 7:152785377-152785399 GAGGGGGGGGGGAGGGGAGGGGG + Intronic
1035238621 7:157516065-157516087 GGGTGGGAGGGGAGAGCAGCTGG + Intergenic
1035277345 7:157755728-157755750 GAGGGGGTAGGAAGGGGAGAGGG + Intronic
1035311933 7:157975001-157975023 GAGGGGCTGGGGAGAGCAGAGGG + Intronic
1035356804 7:158280565-158280587 TACCGGGTGGAGAGGGCAGATGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035567624 8:651759-651781 GAGCGGGAGGGGAGGGCATCTGG + Intronic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1035922310 8:3690981-3691003 GTGAGGGTGGGGAGTGCTGACGG + Intronic
1036016707 8:4793461-4793483 GAGATGGTGGGGAGGAGAGAGGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036588410 8:10146495-10146517 GAGTGGCTGCTGAGGGCCGAGGG + Intronic
1036644884 8:10606923-10606945 GAGGCAGTGGGCAGGGCAGACGG - Exonic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1037772414 8:21810349-21810371 CAGTGAGGGGGGTGGGCAGAGGG - Intronic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1037886574 8:22599180-22599202 GAGAGGGTGGGCAGAGGAGAGGG - Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1038142911 8:24865775-24865797 GAGGATGTGGGGAGGGCAGTTGG - Intergenic
1038329123 8:26593732-26593754 GGGTGGGTGCCGGGGGCAGAGGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038568167 8:28637005-28637027 GAGGGGGTGGGGCGGGGAGAGGG + Intronic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1038807986 8:30812468-30812490 GGGCGGGTGGGGAGGGGGGAGGG - Exonic
1038860905 8:31388011-31388033 GAGGGGGAGGGGAGAGGAGAGGG - Intergenic
1038860913 8:31388029-31388051 GAGAGGGAGGGGAGAGGAGAGGG - Intergenic
1039444599 8:37621130-37621152 CAGTGGGTGGGTGGGACAGAGGG + Intergenic
1039452331 8:37685404-37685426 GAGAGGGTGGGAAGGGGAGAAGG + Intergenic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039658791 8:39439538-39439560 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
1039781718 8:40792709-40792731 GAGGAGGTGGGGAGGGGAGGAGG + Intronic
1039838984 8:41280145-41280167 GAGTGCAGGGGGAGGGCTGACGG + Intronic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040336595 8:46419188-46419210 GAGTGGAGTGGGAGGGCAGCAGG + Intergenic
1040414536 8:47184429-47184451 GAGAGCCTGGAGAGGGCAGAAGG - Intergenic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1040484020 8:47853411-47853433 GAGTGATTGGGCAGGGCAGGCGG + Intronic
1040831466 8:51681596-51681618 GGGTGGGAGGAGAGGGCAGCAGG - Intronic
1041263174 8:56039153-56039175 GAGTGAGTGTGTTGGGCAGAGGG + Intergenic
1041709359 8:60879197-60879219 AAGAGGTTGGGGAGGGTAGAGGG - Intergenic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041726070 8:61018469-61018491 GATGGGTTGGGGATGGCAGAGGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042564566 8:70099063-70099085 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043417240 8:80063897-80063919 GAATGGGGGGGAATGGCAGAGGG + Intronic
1043722672 8:83565584-83565606 GTGCGGGTGGTGAGGGGAGATGG - Intergenic
1043960094 8:86407797-86407819 GAGTGGGATGGGAGGACATATGG - Intronic
1043961787 8:86424834-86424856 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044249695 8:89991186-89991208 GGGTGGGTGGGGTGGGGGGACGG + Intronic
1044559338 8:93597136-93597158 GAGTGGGTGGAGAGGCCACCTGG - Intergenic
1044866248 8:96574014-96574036 GAGGGGGTGCAGAGGGCAGGGGG - Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045305218 8:100951938-100951960 GAGTGGGTGGTGGCGGCGGACGG + Exonic
1045881521 8:107045958-107045980 GAGAGGGAGGGGAAAGCAGAGGG + Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1046936052 8:119887117-119887139 GAGGGGGGGGGGAGGGGAGGGGG - Intronic
1046968645 8:120195383-120195405 AAGTGTGTGTGGCGGGCAGAGGG - Intronic
1047060188 8:121216658-121216680 GAGAGAGAGAGGAGGGCAGAGGG + Intergenic
1047306603 8:123657879-123657901 GAGTGGGTTGAGAGGACTGAGGG - Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1047907977 8:129493178-129493200 GTGTGGGAGGGGAGGACAAAGGG + Intergenic
1048204086 8:132401747-132401769 AGGAGGGTGGGCAGGGCAGAGGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048222264 8:132552759-132552781 GACTGAGGCGGGAGGGCAGAGGG + Intergenic
1048278849 8:133089802-133089824 GAGTGGGCAGGGATGGCAGTGGG - Intronic
1048295851 8:133212843-133212865 GCCTGCGGGGGGAGGGCAGAGGG - Exonic
1048350785 8:133614316-133614338 GAGGGGCTGGGGTGTGCAGAAGG + Intergenic
1048398126 8:134034437-134034459 GAGGGGGAGGGGAGGGGAAATGG + Intergenic
1048443346 8:134476168-134476190 GTGTGGGTGGGGCAGGCAGGAGG - Intergenic
1048995491 8:139791489-139791511 GAGTCTGTGGGCAGGGGAGATGG - Intronic
1049105299 8:140608941-140608963 CAGTGGGTGGGGAGGGCCTGTGG - Intronic
1049184731 8:141244075-141244097 GAGTTGATTGGGAGGGCAGTTGG - Intronic
1049358117 8:142198706-142198728 GTGTGGCTGGGGTGAGCAGAGGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049522199 8:143098406-143098428 GAGAGTGTGGGGTTGGCAGAGGG + Intergenic
1049578822 8:143401584-143401606 GGAGGGGAGGGGAGGGCAGAGGG + Intergenic
1049688514 8:143948849-143948871 GAGTGGGTGGGCAGGGGTGCCGG + Intronic
1049693565 8:143973158-143973180 GGGTGGGTGGGGTGGGCCGCGGG - Intronic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1049940921 9:545268-545290 GGGAGGTTTGGGAGGGCAGATGG + Intronic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050309639 9:4339828-4339850 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050486800 9:6142907-6142929 GAGGGTGTGGGAAGGGGAGAAGG + Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050612153 9:7364174-7364196 GTGTTGGAGGGGAAGGCAGAGGG - Intergenic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051221187 9:14850190-14850212 TAGTGGGAGGGGAGGACAGCTGG - Intronic
1051222267 9:14861977-14861999 GAGCGGGTGGGAAGGGTAGTGGG - Intronic
1051642686 9:19238466-19238488 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1051642749 9:19238590-19238612 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1051717555 9:20000878-20000900 GAGAGGGTGTGGAGGACGGAAGG + Intergenic
1051942777 9:22529147-22529169 GGGTGGGTGGGGTGGGGAAAGGG - Intergenic
1052254671 9:26441073-26441095 TGGGGGGTGGGGATGGCAGATGG - Intergenic
1052454516 9:28678228-28678250 GAGTGGGAGAGCAGGCCAGAAGG - Intergenic
1052467647 9:28850451-28850473 GAGTGGGTGGCTGGGGGAGAGGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052951916 9:34219948-34219970 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1052951994 9:34220100-34220122 GAGGGGAGGGGGAGGGAAGAGGG - Intronic
1053329338 9:37188876-37188898 GAGGGGGAGGGGAGAGGAGAAGG - Intronic
1053564423 9:39233298-39233320 GGTGGGGTGGGGAGGGCAGTGGG + Intronic
1053799758 9:41756995-41757017 GAGGGGGGAGGGAGGACAGAGGG - Intergenic
1053830204 9:42071199-42071221 GGTGGGGTGGGGAGGGCAGTGGG + Intronic
1054132727 9:61385738-61385760 GGTGGGGTGGGGAGGGCAGTGGG - Intergenic
1054145453 9:61557939-61557961 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054456481 9:65434007-65434029 GAGTTGGTGGGTGGGGCAGGTGG - Intergenic
1054465192 9:65489047-65489069 GAGCGGGGAGGGAGGACAGAGGG + Intergenic
1054600355 9:67116253-67116275 GGTGGGGTGGGGAGGGCAGTGGG - Intergenic
1054650348 9:67619526-67619548 GAGGGGGGAGGGAGGACAGAGGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054981245 9:71209359-71209381 GAGGGGGTGGGGGGAGAAGAGGG + Intronic
1055576148 9:77661824-77661846 GGTTGGGTGAAGAGGGCAGAGGG - Intergenic
1055673488 9:78631275-78631297 GAGTGGGAGGGGCAGGGAGAAGG + Intergenic
1055979536 9:81988605-81988627 GAGTGGCAAGGTAGGGCAGAGGG + Intergenic
1056173639 9:84012885-84012907 GATTGGGGGTGAAGGGCAGATGG + Intergenic
1056202356 9:84288876-84288898 GAGGGGATGGGGAGTGGAGAAGG + Intronic
1056551526 9:87656924-87656946 GAGTAAGGGGGGAGGGGAGAAGG + Intronic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1057014908 9:91642830-91642852 GAGTGGGTGGAAAGGTCACAGGG + Intronic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057502084 9:95603977-95603999 GGGAGGGTGGGGAGGGGAAAAGG - Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057767434 9:97934434-97934456 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058087170 9:100760905-100760927 GGGTGGGTTGGGATGGCTGATGG + Intergenic
1058161040 9:101571050-101571072 AAGTGGGTGGGGATGGCTAAGGG + Exonic
1058499245 9:105593508-105593530 GAGTGGGTTGGGAGTACAAATGG + Intronic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059357328 9:113710178-113710200 GCGTGGATGGGGAGGGCACCAGG + Intergenic
1059490972 9:114667094-114667116 GGGGGGGTGGGAAGGGCAGAAGG + Intergenic
1059542520 9:115144366-115144388 GAAGGGGAGGGGAGGGGAGAAGG - Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1060124027 9:121024283-121024305 GAGGGGGAGGGGAGGGGAGCGGG + Intronic
1060199951 9:121646505-121646527 GTGGGGGTGGGGGGGACAGAGGG - Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060284434 9:122236439-122236461 AAGTGGTGGGGGTGGGCAGAAGG + Intergenic
1060421639 9:123473319-123473341 GAGGGGCAGGGGAGGGCGGAGGG + Intronic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060558910 9:124526754-124526776 GAGTGGCTGGGGTGGGAAAAGGG - Intronic
1060788403 9:126468576-126468598 GAGTGGCTGGGGAAGGCCAAGGG - Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061098114 9:128471867-128471889 GAGTGGGTGGGCAGAGGATAAGG + Intronic
1061256224 9:129455238-129455260 GGGTGGGTGGGGTGGGCACCAGG - Intergenic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061287248 9:129631096-129631118 GAGGGGGTGGGGCAGACAGAGGG - Intronic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061390608 9:130315322-130315344 GAAGGGAGGGGGAGGGCAGAGGG - Intronic
1061390623 9:130315355-130315377 GAGGGGAGGGGGAGGGGAGAGGG - Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061492270 9:130952230-130952252 GAGGGGGTGGGGGAGGCACATGG + Intergenic
1061724984 9:132577345-132577367 GAGTGAGTGGGGAGGGAAACAGG + Intergenic
1061874214 9:133535850-133535872 GAGGGGGTGGGGAGAGCTGAGGG + Intronic
1061900158 9:133668641-133668663 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1061900206 9:133668761-133668783 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1061938289 9:133870831-133870853 GAGTGGATGGGATGGGCAGATGG + Intronic
1061970823 9:134044296-134044318 GAGAGGGTGGGAAAGGCAGCAGG + Intronic
1062032081 9:134366297-134366319 GCATGGGGGGGGTGGGCAGAGGG - Intronic
1062067299 9:134535634-134535656 GGGTCTCTGGGGAGGGCAGATGG + Intergenic
1062270843 9:135707642-135707664 CAGGGGGTGGGGACAGCAGAAGG + Intronic
1062321089 9:135990835-135990857 GGGCGGGAGGGGAGGGGAGAGGG - Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062399773 9:136367280-136367302 GGGTGGGCTGTGAGGGCAGAGGG + Intronic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062499943 9:136847974-136847996 GAGGCGGTGGGCAGGGCGGACGG + Exonic
1062726783 9:138078598-138078620 GACTGGGTGGGGAGGTCGGCAGG + Intronic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185537306 X:872790-872812 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185537315 X:872808-872830 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186270827 X:7886428-7886450 GAGTGAGTGGGAAAAGCAGAGGG + Intergenic
1186502197 X:10060428-10060450 GAGGGGGTGGGGGGTGCAGAGGG + Intronic
1187073937 X:15915371-15915393 GAGAGGCTGAGGTGGGCAGATGG - Intergenic
1187439702 X:19307193-19307215 GAGTGGGTGGGATGGTCAGGCGG - Intergenic
1187483953 X:19684380-19684402 GACTGGGTGGGGAGGCAACAAGG - Intronic
1187754065 X:22500590-22500612 GTGTGGGGGGGGAGGGCATGTGG + Intergenic
1187956459 X:24523535-24523557 GAATGGGAAGGGAAGGCAGAGGG + Intronic
1187960652 X:24563657-24563679 GAGCTGGTGGGGAAGGGAGAGGG + Intronic
1188182691 X:27075311-27075333 AAGTGGATGGGAAGGGCAAATGG - Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188851761 X:35140826-35140848 GGGTGGGGGGGGAGGGGGGAGGG + Intergenic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1189285050 X:39846225-39846247 GAGTGACTGGAGGGGGCAGAAGG - Intergenic
1189299483 X:39942196-39942218 GAGGGGCTGGGGAGGGGAGCAGG + Intergenic
1189377100 X:40474652-40474674 GGGCGGGGGGGGCGGGCAGAGGG + Intergenic
1189519534 X:41751570-41751592 GAGGGGGTGGGGTGGTCAGATGG + Intronic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190368305 X:49718182-49718204 GACTGGGTGGGGAGGGCACGAGG + Intergenic
1190399180 X:50014588-50014610 GAGAGGGGGAGCAGGGCAGAAGG - Intronic
1190417956 X:50199758-50199780 GAGGGGAGGGGAAGGGCAGAAGG - Intronic
1190741471 X:53291728-53291750 GAGTGGGGTGAGAGGGCAGTTGG - Intronic
1191716656 X:64198355-64198377 GGGTGGCTGAGGAGGGCAAATGG - Intronic
1191739709 X:64423711-64423733 GAGTGGTTGGTGAGTCCAGATGG + Intergenic
1192180711 X:68914068-68914090 GGGTGGGTAGGGAGGTCAGTAGG - Intergenic
1192238858 X:69314027-69314049 GGGTGGGTGGGTACGGCACAGGG + Intergenic
1192264984 X:69531762-69531784 GAGTGTGTAGGCAGGGCACAGGG - Exonic
1192324655 X:70122423-70122445 GAGGGGGAGGGGAAGGGAGAGGG - Intergenic
1192550924 X:72052823-72052845 GAGGGGCTGGGGGGAGCAGAGGG - Intergenic
1192585263 X:72314053-72314075 GAGGGGCTGGAGAGGGGAGAGGG - Intergenic
1192639242 X:72846992-72847014 TAGTGGATGGGAAGAGCAGAAGG + Intronic
1192642469 X:72873813-72873835 TAGTGGATGGGAAGAGCAGAAGG - Intronic
1193642806 X:84032717-84032739 CAGTGGCTGGGAAGGGCAGTGGG - Intergenic
1193836335 X:86349174-86349196 AGGTGGATGGGGAGGCCAGAAGG + Intronic
1194316102 X:92379435-92379457 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194966498 X:100294426-100294448 GAGGGGGTGGGTAAGGCAGTAGG - Exonic
1195025053 X:100868493-100868515 GAGGGAGTGGGTAGGGCACAGGG - Intronic
1195043694 X:101037068-101037090 GACAGGCTGGAGAGGGCAGAAGG + Exonic
1195156369 X:102127113-102127135 GAGAGAGGGGGAAGGGCAGAGGG + Exonic
1195457936 X:105090437-105090459 GAGTGGATGGGAAAGGGAGATGG - Intronic
1195705278 X:107733915-107733937 AAATGGGTGGGAAGAGCAGACGG - Intronic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1196006650 X:110843908-110843930 AGGTGGATGGGGAGGCCAGAAGG - Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196237479 X:113299851-113299873 GAGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196237527 X:113299940-113299962 GAGGGGGAGGGGAGAGGAGAGGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196898589 X:120361734-120361756 GAGTTGGGGGTGAGGGGAGATGG - Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197292043 X:124670463-124670485 GAGTGGCTGAGGAGAGTAGAGGG - Intronic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1197979180 X:132197771-132197793 GAGGGGGCGGGGAGGGGAGGGGG + Intergenic
1198078419 X:133215957-133215979 GTGTGGCTGGGGACAGCAGAGGG - Intergenic
1198807470 X:140505412-140505434 GATTGGGGGGAGGGGGCAGAGGG + Exonic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199758741 X:150889247-150889269 GAGTGGATCTGAAGGGCAGATGG - Intronic
1199794032 X:151178139-151178161 GAGAGGGTGGGGAGACCAGCTGG + Intronic
1199874631 X:151920571-151920593 GATGGGGTAGGGAGTGCAGATGG - Intronic
1200065393 X:153502192-153502214 GAGGGGCTGGGGAAGGCCGAGGG - Intronic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200181765 X:154155212-154155234 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200187414 X:154192326-154192348 GAGTGGGTCAGGGGGGCAAATGG - Intergenic
1200193063 X:154229466-154229488 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200198818 X:154267270-154267292 GAGTGGGTCAGGGGGGCAAATGG - Intronic
1200624149 Y:5491009-5491031 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1200830225 Y:7681509-7681531 GAGTGAATGAGGATGGCAGAGGG - Intergenic
1200965039 Y:9027947-9027969 GTGTGTGTGGGAAGGGCAGGGGG - Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1202075905 Y:21037853-21037875 GAGTGGGGGGGGGGGTCACAAGG - Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202148072 Y:21820832-21820854 GTGTGTGTGGGAAGGGCAGGGGG + Intergenic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic