ID: 920851489

View in Genome Browser
Species Human (GRCh38)
Location 1:209631026-209631048
Sequence TGCCAAGCGCTGCCTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920851489_920851497 23 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851497 1:209631072-209631094 CTGTGGGATCCAGAAGCTGGTGG 0: 1
1: 0
2: 2
3: 61
4: 1200
920851489_920851493 7 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851493 1:209631056-209631078 AGACACCCTTGGCAAACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 158
920851489_920851492 6 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851492 1:209631055-209631077 CAGACACCCTTGGCAAACTGTGG 0: 1
1: 0
2: 2
3: 9
4: 148
920851489_920851491 -4 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851491 1:209631045-209631067 GGCAGGTGCTCAGACACCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 260
920851489_920851499 25 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851499 1:209631074-209631096 GTGGGATCCAGAAGCTGGTGGGG 0: 1
1: 0
2: 2
3: 32
4: 334
920851489_920851498 24 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851498 1:209631073-209631095 TGTGGGATCCAGAAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 232
920851489_920851496 20 Left 920851489 1:209631026-209631048 CCAGTCAGAGGCAGCGCTTGGCA 0: 1
1: 0
2: 1
3: 17
4: 147
Right 920851496 1:209631069-209631091 AAACTGTGGGATCCAGAAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920851489 Original CRISPR TGCCAAGCGCTGCCTCTGAC TGG (reversed) Intronic
900093625 1:931308-931330 TGCCGAGAGCTGCATCTGACTGG - Intronic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
901971280 1:12911222-12911244 TGCCAACCACTCCCTCTGCCAGG + Intronic
902013889 1:13290518-13290540 TGCCAACCACTCCCTCTGCCAGG - Intergenic
902771137 1:18646332-18646354 TGCCCAGAGCTGCCTGTTACAGG + Intronic
902822503 1:18951767-18951789 TGGCCAGCGCTGCCTATGCCTGG + Intronic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
904613251 1:31736579-31736601 TCGCAAGCGCTTCCTCTGCCTGG - Exonic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
910134043 1:83945187-83945209 TGCCAAGCTCTGCCTTTTATTGG - Intronic
910694278 1:89995272-89995294 CGGTAAGCGCTGCCTCTGGCTGG + Exonic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916410026 1:164537995-164538017 TGCCAACTTCTGCCTCTTACAGG - Intergenic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
921311924 1:213853137-213853159 TGCCACCCTCTGCCTCTGCCTGG + Intergenic
921955825 1:220982366-220982388 TGCCAAGTGCCCACTCTGACAGG - Intergenic
923148883 1:231216782-231216804 TGCCATGAGCTGTCTCTGAGAGG - Exonic
924625694 1:245695098-245695120 TGCCAAGCCCGGTCTCTGCCAGG - Intronic
1062847279 10:717747-717769 GGCCATGGGCTGCCTCTGTCCGG - Intergenic
1063015186 10:2070201-2070223 TTCCAAGATCTGCCTCTGAGTGG - Intergenic
1071755186 10:88529327-88529349 TTTCTAGTGCTGCCTCTGACTGG + Intronic
1075220551 10:120580944-120580966 TGCCAACCCCCGCCTCTGTCTGG + Intronic
1075564295 10:123492455-123492477 TGCCAATCTCTGCCTTTAACTGG - Intergenic
1076321145 10:129582379-129582401 TGCTGTGCTCTGCCTCTGACGGG + Intronic
1077044940 11:540558-540580 TGCCAAGGGCTTGCTGTGACGGG + Intronic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1077514797 11:2995036-2995058 TTCCCAGCGCTGCCTCTGCCAGG + Intergenic
1077516923 11:3007613-3007635 TGCTCACCTCTGCCTCTGACTGG + Intronic
1078476760 11:11636816-11636838 TGCATAGCGCTGCCCCTGCCAGG - Intergenic
1079017262 11:16879663-16879685 TGCCCAGCTCTGCCTGTGCCAGG - Intronic
1080654150 11:34245442-34245464 AGCCAAGCACTGCCTGAGACTGG - Intronic
1081076416 11:38679519-38679541 TTCCTAACTCTGCCTCTGACGGG - Intergenic
1086092801 11:83020922-83020944 TGCCAAGAGCTGCAGATGACAGG + Intronic
1087444559 11:98233649-98233671 TGATCAGTGCTGCCTCTGACTGG - Intergenic
1089351881 11:117825908-117825930 TGCCAAGCCCTGCCCCTGCTTGG - Intronic
1089533891 11:119149307-119149329 TGCTCAGCGCTGCCACGGACCGG - Exonic
1090244292 11:125204687-125204709 TGCAAAGAGCTGTCTCTGACCGG - Intronic
1090869158 11:130727358-130727380 TGCCAAGCTCTCCCTCTGGCAGG + Intergenic
1091410052 12:233340-233362 GGGCAGGCCCTGCCTCTGACAGG - Intronic
1097984858 12:65772250-65772272 TGCCAAATGCAGCCTCTGACTGG - Intergenic
1100455479 12:94747576-94747598 GGCCAAGCTCTGCCTCTCACTGG + Intergenic
1101210385 12:102529543-102529565 TGCCAAGAGATGAGTCTGACAGG - Intergenic
1102807236 12:115792814-115792836 TGCCCAGCTCTGCATCTAACTGG + Intergenic
1112348643 13:98614253-98614275 TCCCAAGCTCTGCCTCTGGGAGG - Intergenic
1114496661 14:23137593-23137615 TGCCAACCACAGCCACTGACTGG + Intronic
1117156946 14:52951018-52951040 GGCGAAGCGCTGCCTGTGGCCGG + Intronic
1117745017 14:58860610-58860632 TGCCAACTGCTGCCACTGCCAGG - Intergenic
1118721397 14:68596835-68596857 TGCCAATGTCTGCCCCTGACGGG - Intronic
1118786063 14:69046180-69046202 GGCCAAGCCCAGCCTCTCACTGG + Intergenic
1121277863 14:92679849-92679871 GGCCCAGTTCTGCCTCTGACTGG + Intronic
1121492757 14:94371876-94371898 GGCCAAGGCCTGCCTCTGTCTGG + Intergenic
1124515265 15:30362451-30362473 TGCCAACCGCTTCCGCTGCCAGG - Exonic
1124727657 15:32168278-32168300 TGCCAACCGCTTCCGCTGCCAGG + Exonic
1126905254 15:53358226-53358248 TGACATGCACTGCCTCTGATAGG + Intergenic
1128514003 15:68330997-68331019 TGCCAAGGGCTCCCACTGCCAGG + Exonic
1129362972 15:75036077-75036099 TGCCCAGCGCTGCTTCTACCAGG + Intronic
1131612988 15:93984593-93984615 TCTGAAGCGCTGCCTCTTACTGG + Intergenic
1132576302 16:665943-665965 TCCCCAGAGCTGCCTCTGCCTGG + Exonic
1132813772 16:1816359-1816381 TGAGAGTCGCTGCCTCTGACAGG - Intronic
1134769399 16:16793972-16793994 TGCCAAGCCCTGATTCTGCCAGG + Intergenic
1141255672 16:82400265-82400287 TCCCAGGCTCTGCCTCTGATTGG + Intergenic
1141663971 16:85456332-85456354 CTCCAAGCGCTTCCTCTCACAGG - Intergenic
1142266360 16:89065655-89065677 CGCCAAACGCTCCCTCTGATTGG - Intergenic
1143054677 17:4153997-4154019 TGGCAGGTGCTGCCTCTGAAGGG + Intronic
1144058421 17:11560710-11560732 CCCCAAGCCCTGTCTCTGACAGG + Exonic
1146541596 17:33700756-33700778 TGCAAAGCGCTGTGTCTGAAGGG - Intronic
1149361654 17:55901701-55901723 TGCCAAACCCTGACTCTGGCTGG - Intergenic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1151155096 17:72118468-72118490 TGCCAAGCGTTGCCACCGTCAGG - Intergenic
1151370555 17:73644228-73644250 AGCCAAGCGCTGCCCCTCCCGGG - Intergenic
1151562866 17:74879970-74879992 TGTCAAGTGCTTCCTCTGCCAGG + Intronic
1151563004 17:74880818-74880840 TGTCAAGTGCTTCCTCTGCCAGG - Intronic
1160136396 18:76275054-76275076 GGCCAAGCCTTGCCACTGACAGG + Intergenic
1163154441 19:15432414-15432436 TCCCAAGCGCGGGCTCTTACCGG + Intronic
1163821922 19:19500856-19500878 TGCCAAGCCCTGCCTCAGTGTGG - Intronic
1164771575 19:30813661-30813683 TGCCATGAGCTGCCTCTGTCTGG + Intergenic
1164861454 19:31565229-31565251 AGCTCAGCTCTGCCTCTGACTGG + Intergenic
925291051 2:2748940-2748962 GGCCATGCACTGCCTCTGCCTGG - Intergenic
926216418 2:10908322-10908344 TGCCAAGCTCTGACACTTACTGG - Intergenic
928483196 2:31704440-31704462 TGCCAAGCACTGTTTCTGACTGG + Intergenic
928927869 2:36597475-36597497 TGCCAGGCGCTGCTTCGCACAGG - Intronic
930024932 2:47024145-47024167 TGCCAGGCTCTGCCTCAGAGGGG - Intronic
930601283 2:53445946-53445968 TGCAAACCACTGACTCTGACAGG - Intergenic
932020962 2:68086193-68086215 TGCCCAATGCTGCCTCTGATGGG - Intronic
934646904 2:96064143-96064165 TCCCAAGCCCTGCCTCAGTCAGG + Intergenic
934717892 2:96553775-96553797 TTCCAAGCGAGGCCTGTGACGGG + Intergenic
934840302 2:97620225-97620247 TCCCAAGCCCTGCCTCAGTCAGG + Intergenic
935383848 2:102480881-102480903 TCCCAAGCGCAGCCTCTGTGTGG - Intronic
935744120 2:106176062-106176084 TGCAAAGCAGTGCCTTTGACTGG - Intronic
940376049 2:152960130-152960152 TTCCTAGCTCTGCCTCTGAATGG + Intergenic
944430757 2:199630782-199630804 TGCCAAGGGTTGCCTGTGAGTGG + Intergenic
948060511 2:235040378-235040400 TTCCAAGCTCTGCCTCTGGATGG - Intronic
948200884 2:236129011-236129033 TTCCAACCGCTGCCTCAGACGGG + Exonic
1171036242 20:21714722-21714744 GGCCCAGCCCTGCCTCTGGCCGG + Exonic
1174039683 20:47690085-47690107 TGCTAAGCAGTGCCTCTGGCAGG + Intronic
1176185061 20:63773798-63773820 TGCCCAGCGCTCCATCTGACCGG + Intronic
1177186592 21:17804212-17804234 TGCCAAGCACTGCCACTGAGTGG + Intronic
1180041512 21:45282718-45282740 TGCACAGGGCTGCCTCTGTCCGG - Intronic
1181873596 22:25922633-25922655 GGCCCAGCTCAGCCTCTGACTGG - Intronic
1182577848 22:31285173-31285195 GGCACAGCACTGCCTCTGACTGG - Intronic
1183688418 22:39375039-39375061 TGCCAAAGGCTGCTTCTGAAGGG - Intronic
1183736391 22:39647059-39647081 GGCCCAGCGCAGGCTCTGACAGG - Intronic
1183949811 22:41346485-41346507 TGCCAAGCCCTGCCTATGACTGG - Intronic
1184331972 22:43833148-43833170 CCCCAAGCCCTGCCTCTGCCTGG + Intronic
1184413900 22:44341066-44341088 TGCCCAGCTTTGCCTCTCACGGG - Intergenic
1184504576 22:44893127-44893149 TGTCCAGCCCTGCCTGTGACCGG + Intronic
949711336 3:6874388-6874410 TGCCCGGAGCTGGCTCTGACTGG - Intronic
950424290 3:12916282-12916304 TGCCCAGCTCTGCATCTGAGCGG + Intronic
951509246 3:23483672-23483694 TGCCCAGTGCTGCTTCTTACTGG + Intronic
953637587 3:44676129-44676151 GGACATGCTCTGCCTCTGACTGG - Intergenic
954400484 3:50317076-50317098 TCACTAGCCCTGCCTCTGACGGG - Intergenic
954794107 3:53152813-53152835 TGCTCAGCCATGCCTCTGACTGG - Intergenic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961752420 3:129104671-129104693 TGCCCATCGCTGCCTCAGTCGGG + Intronic
967452047 3:189636206-189636228 TACCATGCGCTGCGTCTGAGCGG + Intronic
968454614 4:690594-690616 TGTGGAGCACTGCCTCTGACAGG + Intergenic
968631486 4:1654372-1654394 TGCCAACCACGGCCTGTGACGGG + Intronic
968762149 4:2448283-2448305 TGCCAAGCACAGCCCCTGCCTGG + Intronic
968856397 4:3127411-3127433 TGACAAGCTCTGCCACTGATGGG + Exonic
969917628 4:10506360-10506382 TGCCAGGGGCTGCATCTCACTGG - Intronic
972713754 4:41624928-41624950 TGCCAAGCCCTGCCTCCAACTGG - Intronic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
983535967 4:168857240-168857262 TACAGAGCGCTGCCTCTGGCAGG - Intronic
984735934 4:183108225-183108247 TGACAAGCGCTGCCTCCATCAGG + Intronic
994214112 5:97117815-97117837 TGCCAAGCTCTGTCTCTAAAAGG - Intronic
995435150 5:112127565-112127587 TTCCAATCCCTTCCTCTGACTGG + Intergenic
997405400 5:133642297-133642319 AGCCAAGCACTGCATCTGAATGG + Intergenic
1000980393 5:167810731-167810753 TGACAAGTGTGGCCTCTGACTGG - Intronic
1002601216 5:180354793-180354815 TGCCAGGCTCTGCCTGGGACTGG + Intergenic
1003050886 6:2780376-2780398 TTCCAAGCGCTGCCTCTTCGTGG + Intronic
1008186916 6:48404431-48404453 AGCCCAGCACTGCCTATGACTGG + Intergenic
1008892199 6:56507822-56507844 TGGCAGGGGATGCCTCTGACGGG + Intronic
1009246246 6:61242261-61242283 TGCCAGGCGCTGTGGCTGACTGG - Intergenic
1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG + Intergenic
1011551014 6:88531105-88531127 AGCCAAGCTCTCCCTCTGAGAGG + Intergenic
1013779081 6:113710558-113710580 TGCAAAGAGCTGCCAATGACTGG + Intergenic
1016731399 6:147431999-147432021 TCCCCAGCGCTGCCTGTGCCAGG + Intergenic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019152399 6:170017435-170017457 TGCCAAGCTGTGCCTTTCACTGG - Intergenic
1019287890 7:232741-232763 TGCCTAGCGCCGCGGCTGACCGG + Intronic
1020077212 7:5266307-5266329 TGCCGGTCGCTGCCTCTGTCTGG - Intergenic
1024965983 7:55022199-55022221 AGCAAAGCCCTGCCTCTTACAGG + Intronic
1026607673 7:71829545-71829567 TGCCAAGAGCTCACTCTGTCTGG + Intronic
1032954403 7:136953891-136953913 AGCACAGCACTGCCTCTGACTGG + Intronic
1033017638 7:137688054-137688076 TGCCAAGCTCTGGCTCAGGCAGG + Intronic
1034882167 7:154771013-154771035 TGCCATGAGCTGCCTCTGCCAGG + Intronic
1034934610 7:155190755-155190777 TACCAAGCGCGGCCACTGAGCGG + Intergenic
1036263696 8:7258983-7259005 GTCCAAGCGCGGCCTCTTACTGG - Intergenic
1036267599 8:7281849-7281871 GTCCAAGCGCGGCCTCTTACTGG - Intergenic
1036301603 8:7572904-7572926 GTCCAAGCGCGGCCTCTTACTGG + Intergenic
1036302901 8:7580553-7580575 GTCCAAGCGCGGCCTCTTACTGG + Intergenic
1036315737 8:7717522-7717544 GTCCAAGCGCGGCCTCTTACTGG - Intergenic
1036352456 8:8020897-8020919 GTCCAAGCGCGGCCTCTTACTGG + Intergenic
1038505720 8:28083184-28083206 AGACAAGCGCTGCCTCTACCAGG + Intronic
1040636137 8:49275057-49275079 TGCCTAGCTCTGCCTCTCTCAGG - Intergenic
1056502571 9:87224150-87224172 TCTCAAGCGCTGGCTCTGACAGG + Intergenic
1056654483 9:88497825-88497847 TGCCACTGTCTGCCTCTGACAGG + Intergenic
1060208469 9:121696489-121696511 TCCCAGGAGCTGCCTCTGAAGGG + Intronic
1061369003 9:130187443-130187465 TGGCCAGGGCTGCCTCTGCCTGG + Intronic
1061865270 9:133488892-133488914 TGCCTCGGGCAGCCTCTGACGGG - Intergenic
1186209508 X:7234567-7234589 AGGCCAGAGCTGCCTCTGACTGG - Intronic
1188506459 X:30889341-30889363 TGCCAAGCTCTCGCTCAGACCGG - Intronic
1197313338 X:124932971-124932993 TCCCAAGAGTTGCCTCTGAAAGG + Intronic
1197550319 X:127885156-127885178 TGCTGAGCCCTGCCTCTGGCAGG + Intergenic
1199263956 X:145808599-145808621 TGCCCAGCACTGCCTGGGACTGG - Intergenic