ID: 920851593

View in Genome Browser
Species Human (GRCh38)
Location 1:209631786-209631808
Sequence CTCTGTACACCTCTGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920851586_920851593 11 Left 920851586 1:209631752-209631774 CCTGACAGATGACACACTCCCTG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG 0: 1
1: 0
2: 3
3: 24
4: 244
920851588_920851593 -7 Left 920851588 1:209631770-209631792 CCCTGAGCTGGCCTCCCTCTGTA 0: 1
1: 1
2: 1
3: 18
4: 172
Right 920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG 0: 1
1: 0
2: 3
3: 24
4: 244
920851585_920851593 12 Left 920851585 1:209631751-209631773 CCCTGACAGATGACACACTCCCT 0: 1
1: 0
2: 1
3: 16
4: 162
Right 920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG 0: 1
1: 0
2: 3
3: 24
4: 244
920851589_920851593 -8 Left 920851589 1:209631771-209631793 CCTGAGCTGGCCTCCCTCTGTAC 0: 1
1: 0
2: 1
3: 22
4: 225
Right 920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG 0: 1
1: 0
2: 3
3: 24
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920851593 Original CRISPR CTCTGTACACCTCTGCAGCC TGG Intronic
900494065 1:2968471-2968493 CTCTGTGCCCCTCTGCAGCCTGG + Intergenic
900505996 1:3029997-3030019 CTCAGGACACCTCTGCCACCAGG + Intergenic
900542922 1:3212966-3212988 CTGTGTCCAGCTCTGCTGCCAGG - Intronic
901215987 1:7555665-7555687 CTCTGGTCACATTTGCAGCCTGG + Intronic
901229249 1:7632889-7632911 CTCAGCTCCCCTCTGCAGCCTGG + Intronic
902679950 1:18036314-18036336 GTCTGTCCAGCTCTACAGCCTGG + Intergenic
904599472 1:31665668-31665690 CTCTTTCCACCTGGGCAGCCAGG - Intronic
906743777 1:48207492-48207514 CTGTGCAGCCCTCTGCAGCCTGG - Intergenic
907706742 1:56839096-56839118 CTCTGTGCAGCCCTGCAGCAGGG + Intergenic
909882096 1:80892450-80892472 CTTTGGTCACCTCTGCATCCTGG - Intergenic
911054036 1:93695671-93695693 CTCTGTAATTCTCTGCAGTCAGG + Intronic
915175192 1:154008630-154008652 CTCACTACACCTCTGCCTCCCGG - Intronic
916398592 1:164420261-164420283 CTCTCTGAACCTCTTCAGCCTGG + Intergenic
917678354 1:177341131-177341153 ATCTGTACACCTCGGCAGCAGGG - Intergenic
917708562 1:177659840-177659862 CTCTGTACACCTTTACATGCAGG - Intergenic
919942384 1:202297284-202297306 CTCAGAACAGTTCTGCAGCCAGG + Intronic
920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG + Intronic
921971388 1:221153106-221153128 CTCTGTGCTCCTCGGCACCCTGG - Intergenic
923444412 1:234055229-234055251 CTCTGTAGACCTCTGGGGGCAGG - Intronic
923451998 1:234126732-234126754 TTCTGTACTCCACTCCAGCCTGG - Intronic
924794749 1:247285152-247285174 CTCTGCACCCCACTGCAGCGGGG + Intergenic
1062817702 10:512873-512895 CACTGTACTCCACTCCAGCCTGG + Intronic
1064283154 10:13969392-13969414 CTCAGTTCAACTCTGCAGACAGG - Intronic
1065902492 10:30221240-30221262 CTCTGAACATCTTAGCAGCCGGG - Intergenic
1069535389 10:69249093-69249115 CTCTGTTCTCTTCTGCAGCTTGG + Intronic
1069545348 10:69323975-69323997 AGCTGTATACCTCTGCATCCAGG + Intronic
1070546467 10:77456713-77456735 CACAGTGCACTTCTGCAGCCTGG - Intronic
1070547802 10:77466127-77466149 CTCTCTGCCCCTCTGAAGCCTGG + Intronic
1071006518 10:80889883-80889905 CTCTGAACATGTCTGCATCCTGG - Intergenic
1071292310 10:84196626-84196648 CTCTGTCCAGCTCTTCAACCAGG - Exonic
1072322663 10:94265937-94265959 CTCGGTAGAACTCTACAGCCAGG + Exonic
1075253910 10:120908792-120908814 CCCTGTACTCCTCTTCATCCTGG - Exonic
1076304312 10:129453412-129453434 TGCTGTACAGGTCTGCAGCCTGG + Intergenic
1077916702 11:6616266-6616288 ATGCTTACACCTCTGCAGCCTGG - Intronic
1078854090 11:15192152-15192174 CTCTGGGCTCCTCTTCAGCCTGG - Intronic
1079349246 11:19678786-19678808 CTCTGTTCACATCAGCTGCCTGG - Intronic
1079918310 11:26399035-26399057 ATTTGTACACCTCTTCAGCTTGG + Intronic
1083356516 11:62070357-62070379 CTCTGCAGAGCTCTGCAGTCAGG - Intergenic
1083749348 11:64752846-64752868 CTGTGTTCACCTCCACAGCCAGG + Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085472272 11:76766133-76766155 CTCTGTTCACCACTCCAGCAGGG + Intergenic
1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG + Intergenic
1089728993 11:120508824-120508846 CACTGTACTCCACTCCAGCCTGG + Intergenic
1090065888 11:123503128-123503150 CTGTGAAGTCCTCTGCAGCCTGG + Intergenic
1091220851 11:133929360-133929382 CTCTGGATTCCTCTGGAGCCTGG - Intronic
1091622207 12:2097760-2097782 CTCAGGCCACCTCTGCAGCTGGG + Intronic
1092539668 12:9413137-9413159 CTCTGTTTCCCTCTTCAGCCAGG + Intergenic
1092727427 12:11499549-11499571 CTCTGTTTTCCTCTGCAGCCAGG + Intronic
1095462840 12:42460526-42460548 CTCTGCACTCCTGTGCAGCATGG + Exonic
1096114480 12:49047454-49047476 CACTGTACTCCACTCCAGCCTGG - Intronic
1098860501 12:75704508-75704530 CTCTGAACACCTGTGCAGGCTGG + Intergenic
1099617385 12:84954202-84954224 CTTAGGGCACCTCTGCAGCCTGG + Intergenic
1099979290 12:89580545-89580567 GTCTGTATCCCTCTGCAACCTGG - Intergenic
1101878736 12:108612300-108612322 CTCTGTCCACTTCTGCCCCCAGG + Intergenic
1102739599 12:115195454-115195476 CTCACTACAACTCTGCAGGCTGG + Intergenic
1103723002 12:122984641-122984663 CTCTGTGCACCTCCCCAGCCCGG + Exonic
1103923893 12:124413265-124413287 CTGTGTCCACCTCTGCAGCGTGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1107177165 13:37412081-37412103 CACTGCACACCACTCCAGCCTGG + Intergenic
1109775812 13:67039645-67039667 CTCTATATACCTCTTCAACCTGG + Intronic
1109943999 13:69407610-69407632 TTCTGTGCACCTCTGCCTCCCGG - Intergenic
1110634569 13:77751662-77751684 CTCTTTATACTTCTCCAGCCTGG - Intronic
1112008647 13:95275704-95275726 CTCTGTACTGCACTCCAGCCTGG + Intronic
1113578724 13:111413522-111413544 CTCTGCACACTTCTGCAGCAAGG - Intergenic
1113981389 13:114280006-114280028 CTCTGCACACCTCTGAAGCCAGG - Intergenic
1114506342 14:23217401-23217423 CTCTGGACACCTCTGAGTCCTGG + Intronic
1115524524 14:34266472-34266494 CCCTGGACACCTGTGTAGCCTGG - Intronic
1116822477 14:49638994-49639016 CTCTTGACTCCTGTGCAGCCTGG + Intergenic
1117763200 14:59054425-59054447 ATCTGGATGCCTCTGCAGCCTGG - Intergenic
1118064492 14:62176043-62176065 GCCTGTCCACCTCTGCAGCATGG - Intergenic
1118747661 14:68785715-68785737 CTCTGAGCTCCTCTGCAGCTAGG - Intergenic
1118934138 14:70270867-70270889 CACTGTACTCCACTCCAGCCTGG - Intergenic
1119194121 14:72704432-72704454 CTCTGTACACCTCCCATGCCAGG + Intronic
1119658831 14:76436417-76436439 CTCTGGAGCCCTCTGCAGCCTGG + Intronic
1120031939 14:79651696-79651718 CTCTGTACACCTGTGCACACTGG + Intronic
1121464186 14:94103594-94103616 CTCTGTGATCCTCTGTAGCCAGG - Intronic
1122401870 14:101472177-101472199 CTGAGTCAACCTCTGCAGCCGGG + Intergenic
1122409485 14:101518608-101518630 CTCTTCTGACCTCTGCAGCCGGG + Intergenic
1124832559 15:33163081-33163103 CACTGTACTCCACTCCAGCCTGG + Intronic
1125352140 15:38779188-38779210 CTCTATAGACCTCTGCAGGCAGG - Intergenic
1127169172 15:56281302-56281324 ATCAGTACCCGTCTGCAGCCTGG - Intronic
1127430690 15:58904619-58904641 CTCTGCAAACCTCTGCCTCCCGG + Intronic
1127525865 15:59791737-59791759 CTCCGTTCCCTTCTGCAGCCAGG + Intergenic
1128300814 15:66565406-66565428 CTCTGCAGGCCCCTGCAGCCAGG + Exonic
1128545498 15:68564345-68564367 CACTCTACCCCACTGCAGCCTGG - Intergenic
1129490747 15:75923096-75923118 CTCTGTCCACCTGAGCATCCTGG + Intronic
1129513595 15:76142813-76142835 CTCTCTTCACCTCTGCACTCAGG + Intronic
1131743153 15:95416369-95416391 CTCTGTACACTTCAGCCTCCTGG - Intergenic
1132517353 16:371941-371963 CTCTGATGACCTCTTCAGCCAGG - Exonic
1132735362 16:1383421-1383443 CTCTCAGCACCTCTGCAACCAGG - Intronic
1132935953 16:2481183-2481205 CTCTGTACTCCTCTGCACTCAGG + Intronic
1133398955 16:5470750-5470772 GTCTGTCCGCCTCTGCAGCCTGG + Intergenic
1137329180 16:47473105-47473127 CACTGTACTCCACTCCAGCCTGG - Intronic
1137578866 16:49621462-49621484 CTCTGCATGGCTCTGCAGCCCGG - Intronic
1138593646 16:58017382-58017404 CTCTGTCCACCTCTGAAACCAGG - Exonic
1140791238 16:78393124-78393146 CTATGGACACCACTGCTGCCAGG - Intronic
1141818858 16:86431534-86431556 CTCTGTCCACCTCTGAACTCTGG - Intergenic
1142004468 16:87682880-87682902 CTCTGTGCATCTCAGCAGCCTGG - Intronic
1142243761 16:88959042-88959064 CTCTGTTCCCCTCTGAATCCTGG - Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1145941998 17:28747464-28747486 CTCTGTGCACCCCTACAGGCTGG - Intronic
1146413133 17:32606059-32606081 CACTGTACTCCACTCCAGCCTGG + Intronic
1146441495 17:32899432-32899454 CCCTGTACAGGTCTTCAGCCAGG - Intergenic
1146562817 17:33886180-33886202 CTTTGTCCATCTCTTCAGCCAGG - Intronic
1148041853 17:44713573-44713595 CTCACTACACCTCTGCCTCCCGG - Intronic
1148833026 17:50448167-50448189 TGCTGTACAGCTTTGCAGCCTGG - Intronic
1149269507 17:54961294-54961316 CTCTGTGCAGCTTTGAAGCCTGG + Exonic
1149907722 17:60541886-60541908 CTTTGTACAGCTCTGGAGGCTGG - Intergenic
1150107517 17:62473163-62473185 CTCTGTGGAGCTCTGCAACCTGG - Intronic
1152699978 17:81813870-81813892 CTCTGCTCACCTCTGCACCAGGG - Exonic
1152782401 17:82232074-82232096 CTCGGCACCCCTCGGCAGCCAGG + Intronic
1154304552 18:13220665-13220687 CTGTAAACACCTCTGCAGACGGG - Intronic
1157565141 18:48674771-48674793 CTCTGTGAACCCCTGCTGCCAGG + Intronic
1157739105 18:50076249-50076271 TTCCGTACAGTTCTGCAGCCAGG - Intronic
1158685260 18:59607999-59608021 CTCACTACACCTCTGCTTCCTGG - Intronic
1160625942 18:80205089-80205111 CTCTGAACACGGCTGCACCCTGG + Intronic
1161539951 19:4844592-4844614 CTCTCTACACCTCTGCTTCATGG - Intronic
1162763559 19:12903725-12903747 CTCTGCACGGCACTGCAGCCTGG - Intronic
1163749447 19:19066976-19066998 CACTGCACTCCTCTCCAGCCTGG + Intronic
1167348979 19:48963315-48963337 CTCTGTACCCCTCTGTCTCCGGG + Intergenic
1167466712 19:49654033-49654055 CTCTCCCCACCTCTGCAGTCTGG - Intronic
1167659811 19:50790065-50790087 CTCTGTCCAAGTCTGCAACCAGG + Intergenic
1168475266 19:56670561-56670583 CTCTGTGCACCTCTTCACACAGG - Intronic
926048906 2:9730565-9730587 CTCTGTGCTCTTCTCCAGCCAGG - Intergenic
926171919 2:10558033-10558055 CTCTGTCCTCCGCTGCACCCAGG + Intergenic
927452943 2:23224317-23224339 CTCTGTACAGCAGTGCAGACGGG - Intergenic
929525944 2:42702996-42703018 CACTGTACTCCACTCCAGCCTGG - Intronic
930841180 2:55847215-55847237 CTCTGCAGACCACTGCAGCCTGG + Intergenic
931153209 2:59598164-59598186 ATTTGTTCACCTCTGCACCCCGG - Intergenic
931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG + Intergenic
932274408 2:70441346-70441368 CTCTGTGCATCTTTGTAGCCTGG - Intergenic
933241574 2:79927329-79927351 CACTCTCCACCTCTGCAGGCAGG - Intronic
934818058 2:97347680-97347702 CTGTGGACACCTCTGCCTCCTGG + Intergenic
934819638 2:97360805-97360827 CTGTGGACACCTCTGCCTCCTGG - Intergenic
936160262 2:110079504-110079526 CCTTGGACACCTCTGCACCCGGG - Intergenic
936184402 2:110291850-110291872 CCTTGGACACCTCTGCACCCGGG + Intergenic
936248827 2:110851890-110851912 CTATGTTCACCTCTGCGGCCAGG - Intronic
937829362 2:126403012-126403034 CTCTGGTCACCTCTGCCTCCAGG - Intergenic
940108580 2:150125738-150125760 CACTGTTCACCTCACCAGCCGGG + Intergenic
946166358 2:217866534-217866556 CCCTGGGAACCTCTGCAGCCTGG - Intronic
947688993 2:232117219-232117241 CTCTGTTCACCTCTCCATCAGGG + Intronic
948527188 2:238578409-238578431 CTCTGTGCACCTCCTCATCCTGG + Intergenic
948781331 2:240323734-240323756 CTCTGTCAGCCTTTGCAGCCTGG - Intergenic
949072094 2:242031550-242031572 GTCTTTACACCTCCCCAGCCCGG + Intergenic
1169081071 20:2798058-2798080 CTCTCTCCACCTCTCCTGCCAGG - Exonic
1169674555 20:8139160-8139182 CACTGCCAACCTCTGCAGCCGGG + Intronic
1172770405 20:37379158-37379180 CTCTGGACTCCTCAGCAGACAGG - Intronic
1172972268 20:38882239-38882261 CACTGTCCCCCTCTGCAGGCTGG - Intronic
1173096314 20:40032031-40032053 CTCTGTAGAACTCTGCTGCCTGG + Intergenic
1174302312 20:49591687-49591709 CTTTGTACAGCTCTGGAGTCAGG - Intergenic
1174570256 20:51496379-51496401 CTCTGCACACCCCTGAAGCCTGG + Intronic
1174583824 20:51592313-51592335 CTCTGTTCAGCCCTGTAGCCTGG - Intergenic
1176268774 20:64224439-64224461 CTCTGTTCCCCTCTGGAGGCTGG + Intronic
1179710880 21:43212325-43212347 CTCTGAACAACTCTGCAGTTTGG - Intergenic
1179912678 21:44458590-44458612 CTCTTTTCACCTTTGCTGCCAGG + Exonic
1180135437 21:45859263-45859285 CGCTGGCCACCTCTGCAGCACGG - Intronic
1180822935 22:18844325-18844347 CTGTGATCACCTCTCCAGCCTGG + Intergenic
1180852388 22:19028120-19028142 GCCCGTCCACCTCTGCAGCCTGG - Intergenic
1180957487 22:19747432-19747454 CTCCTCACACCTCTGCAGCCTGG - Intergenic
1181190026 22:21131679-21131701 CTGTGATCACCTCTCCAGCCTGG - Intergenic
1181209178 22:21278825-21278847 CTGTGATCACCTCTCCAGCCTGG + Intergenic
1181220562 22:21362700-21362722 GCCCGTCCACCTCTGCAGCCTGG + Intergenic
1181502731 22:23327371-23327393 CTGTGATCACCTCTCCAGCCTGG - Intergenic
1181653526 22:24275757-24275779 CTGTGATCACCTCTCCAGCCTGG - Intronic
1181770083 22:25118907-25118929 CTCTCTTCACCTCTGCAGAGAGG + Intronic
1184315599 22:43686054-43686076 CACTGCAAACCTCTGCATCCTGG + Intronic
1184438440 22:44494638-44494660 CCCTGTCCACAACTGCAGCCGGG - Exonic
1184554335 22:45225123-45225145 CTCTGTAAGCCTCCGCACCCAGG + Intronic
1184754443 22:46508210-46508232 ATCTGTTCACCTCTGTGGCCAGG - Intronic
1184784317 22:46664437-46664459 CTCTGTGGACCTCAGCAGCGTGG - Intronic
1203217766 22_KI270731v1_random:16624-16646 CTGTGATCACCTCTCCAGCCTGG - Intergenic
1203273075 22_KI270734v1_random:70233-70255 CTGTGATCACCTCTCCAGCCTGG + Intergenic
953129779 3:40126922-40126944 CTCTGCAGACCTCAGCAGGCAGG + Intronic
953606814 3:44417807-44417829 CCCTGTAGCCATCTGCAGCCTGG + Intergenic
956901615 3:73722334-73722356 CTGTGTATAGGTCTGCAGCCTGG - Intergenic
960928600 3:122821305-122821327 CTCTGTCTACTTCTGAAGCCTGG - Intronic
963700559 3:148620015-148620037 CACTGCACTCCACTGCAGCCTGG + Intergenic
967282808 3:187838291-187838313 TTCTGTATAAATCTGCAGCCTGG - Intergenic
968556185 4:1247613-1247635 CTGTGTACCCGTCTGCAGCTTGG - Intronic
968811403 4:2801127-2801149 CTCTCTGCACCCCTGCAGTCTGG - Intronic
969331765 4:6477685-6477707 CACTGTACTCCACTCCAGCCTGG + Intronic
969657253 4:8505420-8505442 CTCCCAGCACCTCTGCAGCCCGG + Intergenic
972821874 4:42711224-42711246 CACTGCACTCCTCTCCAGCCAGG - Intergenic
974730771 4:65862908-65862930 CTCCATGCAGCTCTGCAGCCTGG + Intergenic
976201871 4:82586959-82586981 GCCTGAACACCTCTTCAGCCTGG + Intergenic
977115250 4:93016301-93016323 CTCTATTCACCTCTGAACCCAGG + Intronic
977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG + Intronic
978292353 4:107156829-107156851 CTCTGTACAGCTTTGTAGCCAGG + Intronic
978764731 4:112392563-112392585 CACTGTACTGCACTGCAGCCTGG - Intronic
979145299 4:117239687-117239709 ACCTGGACATCTCTGCAGCCTGG + Intergenic
981117130 4:141004838-141004860 CTCTGTACATGTCTCCATCCAGG + Intronic
982024629 4:151239354-151239376 CTCTCCACACCTCTGCAAGCTGG + Intronic
983502408 4:168514065-168514087 CACTGTACTCCACTCCAGCCTGG + Intronic
984067138 4:175062464-175062486 CTGAGTGCACCCCTGCAGCCTGG + Intergenic
984136497 4:175946724-175946746 CTCTGCCCACCTCTGTAGCCTGG - Intronic
984249724 4:177317645-177317667 CTCTCAACAGCACTGCAGCCTGG - Intronic
984734480 4:183098040-183098062 CCCTGGACTCCTCTCCAGCCGGG - Intergenic
986027337 5:3863446-3863468 CTCTCTCCTCCCCTGCAGCCTGG + Intergenic
986225009 5:5804224-5804246 CTCTGTACACCATTGCTCCCTGG + Intergenic
986587702 5:9335783-9335805 CTATGTTCCCCTCTGCATCCAGG - Intronic
986693090 5:10330242-10330264 ATCTGACCACCTCTGCAGTCTGG + Intergenic
987263119 5:16223226-16223248 CTCAGCACACCACTGCATCCTGG - Intergenic
991424583 5:66477729-66477751 CTCTGGAAAAATCTGCAGCCGGG + Intergenic
994647177 5:102484573-102484595 CACTGTAAACCTCTGCCTCCTGG - Intronic
997378798 5:133420736-133420758 CTCTGTTCATGGCTGCAGCCAGG + Intronic
997425657 5:133801013-133801035 CGAAGTACACATCTGCAGCCCGG + Intergenic
997452031 5:133991428-133991450 CTCTGTACTGCCCTGGAGCCAGG - Intronic
997550341 5:134747008-134747030 CACTGTAAACCTCTGCCACCGGG - Intronic
998168161 5:139856235-139856257 CTTTGTTTACCCCTGCAGCCTGG + Intronic
998192722 5:140041461-140041483 ATCTGTAGATCTCTGCAGCTGGG - Intronic
1000427302 5:161106766-161106788 CTCTGCACTCCACTCCAGCCTGG + Intergenic
1002444905 5:179284423-179284445 CACTGTACTCCACTCCAGCCTGG - Intronic
1003291722 6:4785132-4785154 ATCTGTACAGGTCTGTAGCCTGG + Intronic
1005705588 6:28449224-28449246 CTCTGTGCAGCTTTGAAGCCTGG - Intergenic
1007412745 6:41674392-41674414 CTCTATACACCTCCGCACCCAGG + Intergenic
1010745937 6:79561706-79561728 CTTTGCACACCTCTGCTGACAGG + Intergenic
1011626730 6:89289260-89289282 CTCGATACCTCTCTGCAGCCTGG - Intronic
1016672566 6:146726125-146726147 CTCCATACACATCTGCAGCATGG + Exonic
1018580044 6:165300912-165300934 TTCTGTACACATGTGCTGCCTGG + Intronic
1018710219 6:166493600-166493622 CTCTGTGCCTGTCTGCAGCCTGG - Intronic
1020189109 7:5981288-5981310 CACTGCACAGCTCTCCAGCCTGG - Intronic
1020293807 7:6743369-6743391 CACTGCACAGCTCTCCAGCCTGG + Intergenic
1021725818 7:23547218-23547240 ATCTGGAGACCTCTGTAGCCTGG - Intergenic
1021901333 7:25288692-25288714 ATCTCTACACCTCTGCAACTTGG - Intergenic
1025262322 7:57427162-57427184 CCTGGGACACCTCTGCAGCCCGG - Intergenic
1026994174 7:74605198-74605220 CTCTGCCCACCACTTCAGCCCGG - Intergenic
1027712716 7:81626254-81626276 CCCTGTCCAGCTCTGCAGTCTGG - Intergenic
1029509737 7:100986572-100986594 CTCTGTCTACCCCTGCACCCCGG + Intronic
1030366429 7:108652420-108652442 CACTGAACATCTCTGGAGCCTGG - Intergenic
1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG + Intronic
1032578711 7:133082707-133082729 TGCTGTACATCTTTGCAGCCTGG - Intergenic
1032800267 7:135312169-135312191 CACTGTACTCCACTCCAGCCTGG + Intergenic
1034993387 7:155562215-155562237 CTCTGTGCACCTCTACAGTGAGG + Intergenic
1035018166 7:155784354-155784376 CAGTGTCCAGCTCTGCAGCCTGG - Intergenic
1035269549 7:157711478-157711500 GTCTGTGCTCCCCTGCAGCCCGG + Intronic
1035873688 8:3163895-3163917 ACCTGTGCAACTCTGCAGCCAGG - Intronic
1036207548 8:6816037-6816059 CTGGGTACTCCTCAGCAGCCTGG - Intronic
1036707875 8:11058943-11058965 ATCTGTACAACTTCGCAGCCAGG + Intronic
1037780788 8:21867693-21867715 CTCATTGCACCTCTGCCGCCTGG - Intergenic
1037996080 8:23353151-23353173 CTCAGTAAACCTCTGCTCCCCGG - Intronic
1038508680 8:28109280-28109302 CTCAGAACACCTCAGAAGCCAGG + Intronic
1039273102 8:35904771-35904793 AACTGTACACCTCAGCAGCAGGG - Intergenic
1040800685 8:51336816-51336838 TTCTTTCCACCTCTACAGCCTGG + Intronic
1042600242 8:70492589-70492611 CTCTCTGCACCTCTGCCTCCTGG + Intergenic
1042944594 8:74142491-74142513 CTCTACACAGCTCTGCAGCACGG + Intergenic
1044327509 8:90876132-90876154 CTCTGCCAATCTCTGCAGCCTGG - Intronic
1046600517 8:116311993-116312015 CTCTGTACACCACTGCCACTTGG - Intergenic
1049274474 8:141712944-141712966 CTCTGAAAAGCTCTGCAGCATGG - Intergenic
1049592380 8:143468536-143468558 CTCTCTCCCCGTCTGCAGCCGGG - Exonic
1056943945 9:90977885-90977907 CCCTGTTCTCCTCTGGAGCCTGG - Intergenic
1057076231 9:92139544-92139566 CTCTGTACCCTTCTTCAACCAGG - Intergenic
1057201120 9:93140470-93140492 CTCTGGACACCCCAACAGCCTGG - Intergenic
1057211363 9:93202715-93202737 TACTGGACACCACTGCAGCCGGG + Intronic
1058208338 9:102135778-102135800 CACTGGAGACCTCTTCAGCCTGG - Intergenic
1060022542 9:120144567-120144589 CTGTGCACACCTCTTCAGTCTGG + Intergenic
1061573486 9:131491966-131491988 ACCAGTACAGCTCTGCAGCCCGG - Intronic
1062364559 9:136202674-136202696 CTTAGGAGACCTCTGCAGCCCGG - Intronic
1062580087 9:137225596-137225618 CTCTGCCCACCCCTGCAGGCTGG + Exonic
1062654263 9:137594263-137594285 CTCTGCCCACCCCTGCAGCAGGG - Intergenic
1203453535 Un_GL000219v1:143797-143819 CTCTGGACAGCTCCGCAGCAGGG - Intergenic
1186362829 X:8860798-8860820 CTCTGAGCACCTCTCCTGCCTGG - Intergenic
1186761938 X:12732348-12732370 CTTTGTAAACCACTGCAGACTGG + Intergenic
1187135590 X:16544184-16544206 CACTGTACTCCACTCCAGCCTGG + Intergenic
1190416953 X:50189598-50189620 ATCTTTACAACTCTCCAGCCCGG - Intergenic
1190833820 X:54082142-54082164 CTCTGCACTCCACTCCAGCCTGG + Intronic
1191695516 X:63985860-63985882 CTCTGTGCATCTCTGCAGGCAGG - Intergenic
1192725871 X:73751853-73751875 CTCTGGACACATCTGAGGCCTGG - Intergenic
1193912862 X:87327291-87327313 CTCTGTGCTCCTCAGCACCCTGG - Intergenic
1195943112 X:110181331-110181353 ATCTGTACACCTCTGGAGCAAGG - Intronic
1196101982 X:111856185-111856207 CCCTGTTTACCTCTCCAGCCTGG - Intronic
1198052936 X:132966105-132966127 CTCTGTCCAGCTCTCCTGCCTGG - Intergenic
1200239037 X:154484293-154484315 CTCTGTCCATCTTTCCAGCCTGG + Exonic