ID: 920857272

View in Genome Browser
Species Human (GRCh38)
Location 1:209673482-209673504
Sequence AGGCTGACTCACCTTCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920857267_920857272 9 Left 920857267 1:209673450-209673472 CCAGTCAATTTCAGAATTTTGGG 0: 1
1: 0
2: 1
3: 40
4: 472
Right 920857272 1:209673482-209673504 AGGCTGACTCACCTTCAGAATGG 0: 1
1: 0
2: 3
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920857272 Original CRISPR AGGCTGACTCACCTTCAGAA TGG Intergenic
900719832 1:4168354-4168376 AGGCTGACCCACCCTCAGTCTGG - Intergenic
902948107 1:19858230-19858252 AGGCTGTCTCCTCATCAGAAGGG + Intergenic
903193977 1:21671407-21671429 GGGCTGGCTCATCTTCAGCAGGG + Intergenic
906061985 1:42954861-42954883 AGGGTGACCCAAATTCAGAAAGG + Intronic
906137555 1:43510185-43510207 ATGCTGAGTCATCTCCAGAAGGG + Intergenic
909858617 1:80574543-80574565 AGGCAGACTCACCCTCAAACTGG - Intergenic
915958699 1:160245584-160245606 AAGCTGACTGAACTTCAGGAAGG + Intronic
916329569 1:163599621-163599643 AGGCTGACTCCACTGCAGGAGGG - Intergenic
916687747 1:167162465-167162487 AGGCTGACTGACCTGCAGGTTGG + Intergenic
916697136 1:167249826-167249848 ATGCTGACTCACCTACAGTGAGG + Intronic
916830012 1:168481268-168481290 AGGCTGGCTCACCTGCAGAAGGG + Intergenic
917122124 1:171653930-171653952 TGGCAGACTCACCTCCAGAGTGG + Intergenic
918434912 1:184501178-184501200 AGGCCATATCACCTTCAGAATGG + Intronic
919096836 1:193047600-193047622 AGTCTGATTAACCTTTAGAAAGG - Intronic
920857272 1:209673482-209673504 AGGCTGACTCACCTTCAGAATGG + Intergenic
922739473 1:228007189-228007211 AGGCTCACTCACCACCAGATCGG - Exonic
1062771404 10:104532-104554 AGGGTGACTTGCCTGCAGAAAGG - Intergenic
1063137320 10:3229043-3229065 AGGGTGTCTCACCTGCAGGAAGG + Intergenic
1063494504 10:6494471-6494493 AGTCTGATTGACCTGCAGAAGGG - Intronic
1064519772 10:16188846-16188868 AGGCAGACTCACCCTCAGTTTGG + Intergenic
1066017694 10:31264440-31264462 AGGCTGACACACTTTCAGAAGGG + Intergenic
1066693331 10:38055067-38055089 TGTCTGTCACACCTTCAGAAAGG + Exonic
1067066818 10:43108801-43108823 AGGCTGCCTCAAATTGAGAAGGG + Intronic
1068055056 10:52002552-52002574 AGGGTGAGTCACCTACACAATGG - Intronic
1068474444 10:57507291-57507313 AGGATGACCTGCCTTCAGAAAGG + Intergenic
1069208834 10:65730432-65730454 AGGCTCACTCACATTAAGGAGGG + Intergenic
1069611667 10:69776853-69776875 ACACTGACTAACCCTCAGAATGG + Intergenic
1070564207 10:77591144-77591166 AGGCTGACTAAGCCTTAGAATGG - Intronic
1070668104 10:78359534-78359556 AGGCTGTTGCACCTTGAGAATGG + Intergenic
1072702327 10:97651694-97651716 AGGCAAACTCACACTCAGAATGG + Intronic
1075228785 10:120653665-120653687 AGGCAGACTCACCAGCAGCAAGG + Intergenic
1075422532 10:122312856-122312878 TGGCTTTCTCACTTTCAGAATGG + Intronic
1075649593 10:124118974-124118996 GGGCTGACTCACCTGCAGTTGGG - Intergenic
1077081561 11:726741-726763 AGGCGGGCTCACCTCCAGGAAGG - Exonic
1077894012 11:6440409-6440431 AGACTTACTCTCCTTCACAAAGG - Intronic
1078332467 11:10436581-10436603 AGGATAACTCCCATTCAGAAAGG - Intronic
1078571916 11:12466172-12466194 AGTCTGACTCAACTACAAAATGG - Intronic
1079022206 11:16918382-16918404 AGGCTCACTCACCTTGTGGAAGG + Intronic
1079051052 11:17159971-17159993 AGGCTCACTCACATTAAGCAGGG + Intronic
1079376427 11:19896084-19896106 AGTCTGACTCACTTACAGGAAGG - Intronic
1081306554 11:41518865-41518887 AGTCTGACTAATCTTCAGGAGGG - Intergenic
1084007694 11:66332016-66332038 AGGCTGGCTCACCCTCAGCTGGG + Intronic
1085388822 11:76171933-76171955 AGGCCGACTCCTCTTCAGAATGG - Intergenic
1088287952 11:108207022-108207044 AGGATGACTTGCCTGCAGAAAGG - Intronic
1088560049 11:111105523-111105545 AGGCTGAGTGACCTGCAGATTGG - Intergenic
1089304196 11:117516550-117516572 AAGCTGACTGACGTGCAGAAGGG - Exonic
1090154088 11:124419153-124419175 AGGCTGACTTTCAGTCAGAATGG - Intergenic
1091953467 12:4615379-4615401 AGGCTGAGTGACCTTCAGCAGGG + Intronic
1092013755 12:5139239-5139261 TGGCTGGCTCACATTCACAATGG + Intergenic
1096120986 12:49089385-49089407 AGGGTGATTCACCTCCAGAGAGG - Intergenic
1097366693 12:58722531-58722553 AGGCAGACCCACCTTCAGTCTGG - Intronic
1097907137 12:64931932-64931954 GCTCTGACTCTCCTTCAGAAGGG + Intergenic
1098093266 12:66926738-66926760 AAGCTGACTCTCATTCAGCATGG + Intergenic
1098613053 12:72485586-72485608 ATGCTGCCTCACCTGTAGAATGG - Intronic
1098627002 12:72684022-72684044 AGGCAGACTCACCTTCAATCTGG + Intergenic
1099146790 12:79056415-79056437 AGCATGACTCACTTCCAGAAAGG + Intronic
1099599279 12:84712201-84712223 AGCCTGACTAAGCTTCAGACAGG + Intergenic
1099636716 12:85222877-85222899 CTGCTCACTCACGTTCAGAATGG + Intronic
1101148848 12:101866467-101866489 CCCCAGACTCACCTTCAGAAAGG + Intergenic
1106557163 13:30819461-30819483 CAACTGACTCACCTACAGAAAGG + Intergenic
1109832468 13:67809774-67809796 AGGCAGTGTCATCTTCAGAATGG - Intergenic
1110521114 13:76477975-76477997 AGTTTGACTAAACTTCAGAAAGG - Intergenic
1111514644 13:89313327-89313349 AGGCTGACTCAGTGTCAGCAAGG + Intergenic
1112231336 13:97591637-97591659 AGGCTGGCTCCCCTTAAGGAAGG - Intergenic
1113503114 13:110793756-110793778 GGGATGACTCACTTGCAGAAAGG + Intergenic
1118950769 14:70434560-70434582 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1119472977 14:74910787-74910809 AGCCTGACTGGCCTCCAGAAAGG + Intronic
1120562806 14:86017694-86017716 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1121851619 14:97226569-97226591 AGGCAGACCCACCCTCAGTATGG + Intergenic
1121946962 14:98132447-98132469 AGGCCCACTCAAATTCAGAAGGG - Intergenic
1124687678 15:31796453-31796475 AGGCTCACCCACATTAAGAAGGG + Intronic
1128515121 15:68337302-68337324 AGGCTGGCCCAGCCTCAGAATGG - Intronic
1128999110 15:72318705-72318727 AGCCTGACTCACCCTGAGAATGG + Intronic
1131305013 15:91234725-91234747 AGGCTGAATCTCCTTGAGGAGGG + Intronic
1131335114 15:91541473-91541495 GGACTGAGTCACCTTCAGCAGGG + Intergenic
1133484823 16:6209681-6209703 AGACTGTCTGATCTTCAGAAAGG + Intronic
1134784021 16:16924539-16924561 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1138817277 16:60217072-60217094 AATTTGACTCACCTTCAGACTGG + Intergenic
1140298191 16:73729100-73729122 GGGCAGACTACCCTTCAGAATGG - Intergenic
1140598476 16:76444961-76444983 AGGTTGGCTCACCTTGAAAAAGG - Intronic
1140750652 16:78020413-78020435 AGGCTCAATCACCTTTAAAATGG + Intergenic
1142171602 16:88625373-88625395 AGGGTGACTCAGATCCAGAAGGG - Intronic
1142996526 17:3763857-3763879 GGGCTGACTTACCTACAGGATGG + Exonic
1143095407 17:4476110-4476132 GGGCTGACTCAGCTCCAGGAGGG - Intronic
1144485337 17:15659867-15659889 AGCCGCACTCACCTTCAAAAAGG + Intronic
1153409047 18:4772953-4772975 AGGCTGACTCGCCTTACGTATGG + Intergenic
1155492733 18:26416158-26416180 AGGCTGAGCCACCTTCACAGGGG - Intergenic
1155814329 18:30286185-30286207 AGGCTGACTAAACTTTAGACAGG + Intergenic
1156773409 18:40757893-40757915 AGGCTCACCCACATTAAGAATGG - Intergenic
1157943793 18:51956657-51956679 AGGCTGACTCCCCCTAAAAAGGG + Intergenic
1158816459 18:61103491-61103513 AGGCAGATTCACCTTCAGTCTGG + Intergenic
1162095858 19:8309597-8309619 AGGATGAATCAGATTCAGAAAGG - Intronic
1162294560 19:9804213-9804235 AGGCTGAATGAACTCCAGAATGG - Intergenic
927028566 2:19096340-19096362 AGGCAGACCCACCTTCAGTGTGG + Intergenic
928353396 2:30584383-30584405 TGGCTGAATCACATTTAGAATGG + Intronic
928552560 2:32387213-32387235 AGGATGACTCCCCTTGAGAAAGG - Intronic
928638762 2:33275913-33275935 CAGCTGACTCACCCTCACAACGG - Exonic
929101951 2:38323880-38323902 AAGCTGACTCCCTTTCACAATGG + Intronic
930058986 2:47272973-47272995 GTGCTGGGTCACCTTCAGAACGG - Intergenic
931235327 2:60407814-60407836 AGGCTTGCTCACTTGCAGAAGGG - Intergenic
932485352 2:72081202-72081224 AGGCTGACTTACCTACAGGGAGG + Intergenic
938772381 2:134511452-134511474 AACCTGACTCACATTCAAAAAGG + Intronic
938904269 2:135823889-135823911 TGGCCCACTCACCTTCAAAAAGG + Exonic
939213162 2:139204399-139204421 AAGCTCACTCACATTCAGGAGGG + Intergenic
940021391 2:149159845-149159867 AGGCTCACTCACATTATGAAAGG + Intronic
942403587 2:175629477-175629499 AGGCTTCCTCACCTGTAGAAAGG - Intergenic
943086300 2:183315695-183315717 AAGCTGACTCAGCTTCAGGAAGG - Intergenic
945594087 2:211769875-211769897 AGGCAGACTCACCCTCAATATGG - Intronic
946017946 2:216619329-216619351 AGTTTGCCTCACCTTCAGGAAGG + Intergenic
946582031 2:221140114-221140136 AAGCTGACTTTCCTTCAGAACGG + Intergenic
946790456 2:223296043-223296065 AGGCAGACCCACCTTCAGTGTGG + Intergenic
947028085 2:225761788-225761810 AGGCTGACCCACCCTCAGTCTGG + Intergenic
1169019492 20:2318927-2318949 AACCTCACTCTCCTTCAGAAGGG - Intronic
1170092485 20:12605587-12605609 AGGCTGGGTCACCTCCAGGAAGG - Intergenic
1170136485 20:13079857-13079879 AGGCTGCCTCACCTCCAACAGGG - Intronic
1171424202 20:25039447-25039469 AGGCTGATTCTCATTCAAAAGGG + Intronic
1172008220 20:31831637-31831659 GTGCTGAGTCACCTTCAGAGGGG - Intronic
1175056212 20:56200952-56200974 ATGGTGACTAACATTCAGAAGGG + Intergenic
1175899351 20:62353912-62353934 AGGCAGACTCAGCTTCAAGAGGG - Intronic
1179286899 21:39985294-39985316 AGGCTGACCCATCTCCAGAATGG + Intergenic
1179347893 21:40578226-40578248 ACTCTTACACACCTTCAGAAAGG + Intronic
1179610179 21:42545175-42545197 AGGCCCACTCACCTACAGGAAGG + Intronic
1181757233 22:25032508-25032530 AGGCCAAGTAACCTTCAGAAAGG - Intronic
1181969967 22:26682395-26682417 TGGATGACCCACCTTCAAAATGG - Intergenic
1184522657 22:45004600-45004622 AAGCTTACTCTCCTCCAGAAAGG - Intronic
951644060 3:24867589-24867611 AGGCTCCCTCCCCTACAGAAGGG - Intergenic
959425155 3:106178176-106178198 AGGCACACTCACCCTCAGTATGG - Intergenic
960672251 3:120165177-120165199 AGGCTGACCCACCCAAAGAAGGG - Intronic
961961459 3:130859626-130859648 AGGATGGAACACCTTCAGAAGGG - Intronic
962182012 3:133216312-133216334 AGGCTCACTCTCCTTAAGTAAGG + Intronic
964531178 3:157669487-157669509 AGGCTGACAAACCTGCAGACAGG - Intronic
974229586 4:59092166-59092188 AGGCTGACCTGCCTGCAGAAAGG + Intergenic
975127244 4:70796736-70796758 AGGATAACTCACTTTAAGAAGGG - Intronic
975386429 4:73765040-73765062 AGGCAGACCCACCTTCAGTCTGG - Intergenic
977120790 4:93098386-93098408 AGGCAGACTCACCATCAGAGAGG + Intronic
977893206 4:102335792-102335814 ATGGTGACTCACCTTCAGAGAGG - Intronic
979637860 4:122977957-122977979 AGGATGACCTACCTGCAGAAAGG - Intronic
980121464 4:128732289-128732311 ATGCTGACTCAGCTTCTGAGGGG + Intergenic
980823647 4:138047929-138047951 AGCCAGACTTACCTTAAGAATGG + Intergenic
981106821 4:140891269-140891291 AGGCTACCTAACTTTCAGAAAGG + Intronic
981671237 4:147289393-147289415 AGGATGATTCACCTCCAGGATGG + Intergenic
982949494 4:161672201-161672223 TGCCTGACTCAACTTCAGACAGG + Intronic
984161362 4:176256381-176256403 AGGCTTAGCCACCTTCAGACAGG + Intronic
984432745 4:179668906-179668928 AGGCAGACTCATCCTCAGACTGG + Intergenic
984676948 4:182560367-182560389 TGGCTGAATCACCTTGGGAATGG - Intronic
985478925 5:95212-95234 AGGCTGTGTCAGCCTCAGAAAGG - Intergenic
985854219 5:2412625-2412647 AGGCTGCCTCCCCTGCAGAAGGG + Intergenic
986927363 5:12772480-12772502 AGGCTGACTCACCCTCAATGTGG + Intergenic
987731113 5:21774161-21774183 AGGCAGACTCACCCTCAGTCTGG + Intronic
995927044 5:117386655-117386677 AGGATGACTTGCCTGCAGAAAGG + Intergenic
999528629 5:152436741-152436763 AGGCTGAATAAACTGCAGAAGGG + Intergenic
1001534909 5:172491419-172491441 AGGGTGACTCACCTGCAGACAGG + Intergenic
1003572841 6:7267282-7267304 AGGCTCACCCATCTTCAGATCGG + Intergenic
1007294015 6:40807573-40807595 AGGCTGACTCACTCTCAGTCTGG + Intergenic
1007643779 6:43364860-43364882 AGGCTGAAACAGATTCAGAAAGG - Intronic
1014786893 6:125629960-125629982 AGGCTCAGTGACCCTCAGAATGG + Intergenic
1014981039 6:127946761-127946783 AGGCTGATTGACCATGAGAAAGG + Intergenic
1015110461 6:129586966-129586988 CCGCTGACTCTCCTTCATAAGGG + Intronic
1016190057 6:141254299-141254321 AGGAAGACTCACCTTCAGTGTGG + Intergenic
1016777443 6:147920171-147920193 AGGCAGACCCACCTTCAGTCTGG + Intergenic
1017424397 6:154305685-154305707 AGGCAGACCCACCTTCAATACGG + Intronic
1018098795 6:160417862-160417884 AGGCTGAGAGACATTCAGAATGG + Intronic
1018239921 6:161763620-161763642 AGGCTGAGGCACATTCAGCAAGG + Intronic
1018355180 6:163007502-163007524 AGGGTGTCTCACTTTCAAAAGGG - Intronic
1020986106 7:15136440-15136462 ATGATGACTCAACTGCAGAAAGG - Intergenic
1021677711 7:23097711-23097733 AGGATGACCTACCTGCAGAAAGG + Intergenic
1022317120 7:29255659-29255681 TGGGTGACTCAAGTTCAGAATGG + Intronic
1024040089 7:45546187-45546209 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1026446497 7:70488838-70488860 TGGCTGTCTCACCTTGGGAAAGG - Intronic
1027699797 7:81455967-81455989 AGGCAGACCCACCTTCAGTCTGG + Intergenic
1027807848 7:82852346-82852368 AGGCTGACCCACCCTCAGTCTGG + Intronic
1030866468 7:114706407-114706429 AGGCTGACTCAACCACAGAGGGG - Intergenic
1031474652 7:122206825-122206847 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1031767434 7:125799200-125799222 AGGCAGACCCACCTTCAGTGTGG - Intergenic
1032080366 7:128855529-128855551 AGGCAGACACACCCTGAGAAAGG - Intronic
1033208693 7:139444173-139444195 AGGCAGACCCACCCTCAGTATGG - Intergenic
1034886802 7:154804585-154804607 AAGATCACTCACCTTCTGAAGGG - Intronic
1036208037 8:6819525-6819547 AGGCTGCCTCACACTCTGAATGG + Intronic
1038141603 8:24851037-24851059 AAGCTGACTGACGTTCATAAGGG - Intergenic
1039285716 8:36038568-36038590 TGGTACACTCACCTTCAGAAGGG + Intergenic
1040898201 8:52390198-52390220 GGGCTGACACAGCTTCAGAGTGG + Intronic
1042879673 8:73473189-73473211 AGGCTGACCCGGCTTCAGATGGG + Intronic
1045435336 8:102157704-102157726 AGGCTGACTCTCATTCAAGATGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048625862 8:136184318-136184340 AGGCAGACCCACCTTCAGTCTGG - Intergenic
1052396348 9:27943260-27943282 TGGCTGACCCATCTTCAGTATGG + Intergenic
1053451772 9:38199553-38199575 AGGTTGACTCATTTTCAGACAGG + Intergenic
1054724230 9:68634290-68634312 AGGCAGCCTCACCTGCAGAGGGG - Intergenic
1055800110 9:80025354-80025376 AGGCAGACTCACCTTCAAGCTGG - Intergenic
1056249694 9:84734896-84734918 AGACTGACCCACCCTCTGAAAGG - Intronic
1058019681 9:100074586-100074608 AGGCTGAGTCCCCTTGAGGAAGG + Intronic
1059681569 9:116590906-116590928 AGGATGACCTGCCTTCAGAAAGG + Intronic
1060798258 9:126527034-126527056 AGGCTCCCCCACCTTCAGGAAGG + Intergenic
1061190630 9:129080818-129080840 AGGCAGCCTCACCTTCTGATTGG + Intergenic
1061656618 9:132096591-132096613 AGGCAGACCCACCCTCAGACTGG - Intergenic
1187221602 X:17331863-17331885 AGGCAGACTCACCTTCAATCTGG - Intergenic
1194071867 X:89334707-89334729 AGGCAGACTCACCCTCAAACTGG - Intergenic
1194410116 X:93546894-93546916 AGGCAGACTCATCTTCAGTGTGG - Intergenic
1194520909 X:94917948-94917970 AGGCTGAGTCACCTTGAGAAAGG + Intergenic
1194833743 X:98657306-98657328 AGGCTGGGTCCCCTTGAGAAAGG + Intergenic
1197380199 X:125729424-125729446 AGGCTGAGTCCCCTTGAGGAAGG - Intergenic
1197387008 X:125814161-125814183 AGGCTGGGTCCCCTTGAGAAAGG - Intergenic
1197497925 X:127208652-127208674 AGGCAGACTCACCTTCAATCTGG - Intergenic
1197554461 X:127937039-127937061 AGGCTGGCTCCCCTTGAGGAAGG - Intergenic