ID: 920857636

View in Genome Browser
Species Human (GRCh38)
Location 1:209675786-209675808
Sequence GGCCGAGCACCACGCCGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920857636_920857644 25 Left 920857636 1:209675786-209675808 CCTCTTCGGCGTGGTGCTCGGCC 0: 1
1: 0
2: 2
3: 4
4: 49
Right 920857644 1:209675834-209675856 CACGGCCGCCAGACGTCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 48
920857636_920857639 7 Left 920857636 1:209675786-209675808 CCTCTTCGGCGTGGTGCTCGGCC 0: 1
1: 0
2: 2
3: 4
4: 49
Right 920857639 1:209675816-209675838 GACTGTGTGCAGCCCCTTCACGG 0: 1
1: 0
2: 3
3: 21
4: 169
920857636_920857643 24 Left 920857636 1:209675786-209675808 CCTCTTCGGCGTGGTGCTCGGCC 0: 1
1: 0
2: 2
3: 4
4: 49
Right 920857643 1:209675833-209675855 TCACGGCCGCCAGACGTCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920857636 Original CRISPR GGCCGAGCACCACGCCGAAG AGG (reversed) Exonic
905307788 1:37031549-37031571 CGCCGAGCACCAGCCCGGAGAGG - Intronic
920857636 1:209675786-209675808 GGCCGAGCACCACGCCGAAGAGG - Exonic
923728114 1:236524419-236524441 GGCCGAGCGCCACCTCCAAGTGG + Intronic
1073268291 10:102241407-102241429 GGCCGGGCACCCGGCCGGAGTGG + Exonic
1075801879 10:125159474-125159496 GGCCGAGCCCCGCGCGGCAGTGG + Intronic
1081032155 11:38097964-38097986 GGCCCAGCACCACATGGAAGTGG + Intergenic
1089525498 11:119094396-119094418 GGCTAAGCACCACGCCGGGGGGG + Exonic
1095356470 12:41280748-41280770 GACAGAGCACCAGGCAGAAGGGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1098971913 12:76866194-76866216 GACCGTGTACCACGCAGAAGAGG - Exonic
1125736279 15:41928724-41928746 TGCCGAGCACCACCCTGAGGGGG + Intronic
1132358762 15:101194029-101194051 GGCCAAGCACCAGGGCAAAGTGG + Intronic
1132564828 16:617100-617122 GGCCAAGACCCACGCGGAAGTGG - Intronic
1132816049 16:1827079-1827101 GGCCGAGCGCCACGCCGCCCGGG + Exonic
1132844081 16:1992078-1992100 GGCCCAGCGCGACGCCGAAGCGG - Exonic
1133141980 16:3751891-3751913 GGCAGAGCACCACGACGAAGGGG + Intronic
1134640126 16:15823378-15823400 GGTTGACCACCACGCAGAAGAGG + Exonic
1136024533 16:27461283-27461305 TGCCGAGCACCAGGCAGGAGTGG + Exonic
1142898923 17:3000462-3000484 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142898944 17:3000561-3000583 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142898983 17:3000759-3000781 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142899004 17:3000858-3000880 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1143056231 17:4164046-4164068 CACTGAGCACCACCCCGAAGGGG + Intronic
1147986064 17:44308503-44308525 GGCCGAGGACCAATCCGCAGAGG - Intronic
1152024868 17:77802514-77802536 GGCAGAGCAGCACGGGGAAGAGG - Intergenic
1158976616 18:62716096-62716118 GGCCGAGGACGACGACGACGAGG - Exonic
1160025454 18:75211866-75211888 GGCCGAGCAGCATGCCGAGGAGG + Intronic
1160222092 18:76985030-76985052 GGGCCAGCACCACGCTGAGGGGG + Intronic
1163720021 19:18894489-18894511 GGGCGAGCACCCCACCCAAGGGG + Intronic
929779049 2:44946106-44946128 GGCCGAGCACCCCGCGGCTGCGG - Intergenic
938015367 2:127862741-127862763 GGCCCAGCACCACACTGAAGTGG - Exonic
946790181 2:223293238-223293260 GGCAGAGCACCTGGCGGAAGGGG - Intergenic
948184394 2:236008580-236008602 GGCCTAGAAACACGCAGAAGTGG - Intronic
1175719681 20:61278558-61278580 GGCTGAGCACCAGGCGTAAGAGG - Intronic
1180060814 21:45383968-45383990 GGCTGAGCACCTCGGCCAAGTGG + Intergenic
1182472255 22:30555771-30555793 GGCCGCGCACCTCGTCGTAGTGG + Exonic
1184241646 22:43214210-43214232 GGCCGAGCTCACCACCGAAGTGG + Exonic
1184571921 22:45330668-45330690 GGTCCAGCACCACCCCGCAGGGG - Exonic
953947985 3:47164802-47164824 GGCAGAGCGCCGCGCCGAGGTGG - Intergenic
955175057 3:56605876-56605898 GGCAGAGCACCAGGGGGAAGGGG - Intronic
961198796 3:125027335-125027357 GGACGGGCTCCAAGCCGAAGTGG + Exonic
961967322 3:130919052-130919074 GGCCGTGCACCACGCAGAAGAGG - Intronic
967876894 3:194273604-194273626 GGCCTAGCTCCAGGCCGATGGGG - Intergenic
968675377 4:1875525-1875547 GGCCAGGCACAAGGCCGAAGTGG - Intronic
973613771 4:52659614-52659636 GGCCGACCCCGACGCGGAAGCGG + Intergenic
990607333 5:57423717-57423739 GGCCGAGCTCCAGGACAAAGTGG + Intergenic
1003175971 6:3752208-3752230 GGTCGAGCACCGCCCCGACGAGG + Intergenic
1018485600 6:164238218-164238240 GGCAGAGCATCAAGCCAAAGAGG + Intergenic
1019577792 7:1745871-1745893 GCACCAGCACCATGCCGAAGAGG - Exonic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1049561772 8:143315743-143315765 GGCTGAGCACAAAGCCCAAGGGG - Exonic
1049665364 8:143840533-143840555 GGGCGAGCGCCAGGCCAAAGGGG + Intronic
1057293050 9:93819265-93819287 GGCCCAGCGCCACCCGGAAGGGG - Intergenic
1188519327 X:31020400-31020422 GGCAGAGCATCAAGCCAAAGAGG + Intergenic
1188561196 X:31470754-31470776 GACAGAGCACCACGGGGAAGGGG - Intronic
1196886404 X:120250670-120250692 GGCAGAGCACGGCGCCGAAGTGG + Intergenic