ID: 920858205

View in Genome Browser
Species Human (GRCh38)
Location 1:209681123-209681145
Sequence AAGTTGCCAAGAGCCCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920858205_920858206 -6 Left 920858205 1:209681123-209681145 CCAATGTGGGCTCTTGGCAACTT No data
Right 920858206 1:209681140-209681162 CAACTTTGTTGAAAATCAGTTGG No data
920858205_920858207 1 Left 920858205 1:209681123-209681145 CCAATGTGGGCTCTTGGCAACTT No data
Right 920858207 1:209681147-209681169 GTTGAAAATCAGTTGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920858205 Original CRISPR AAGTTGCCAAGAGCCCACAT TGG (reversed) Intergenic
No off target data available for this crispr