ID: 920862926

View in Genome Browser
Species Human (GRCh38)
Location 1:209725607-209725629
Sequence GACCTCTCCCCATTTCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920862922_920862926 13 Left 920862922 1:209725571-209725593 CCCAGCTGTCATTGTGGGACTTT 0: 1
1: 0
2: 3
3: 31
4: 737
Right 920862926 1:209725607-209725629 GACCTCTCCCCATTTCTTTCAGG No data
920862923_920862926 12 Left 920862923 1:209725572-209725594 CCAGCTGTCATTGTGGGACTTTA 0: 1
1: 0
2: 2
3: 10
4: 133
Right 920862926 1:209725607-209725629 GACCTCTCCCCATTTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920862926 Original CRISPR GACCTCTCCCCATTTCTTTC AGG Intronic
No off target data available for this crispr