ID: 920864848

View in Genome Browser
Species Human (GRCh38)
Location 1:209743444-209743466
Sequence CAGTCAGAGCAGAAGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920864846_920864848 -4 Left 920864846 1:209743425-209743447 CCAGAGAAGCAGGGAGATACAGT No data
Right 920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG No data
920864843_920864848 25 Left 920864843 1:209743396-209743418 CCAATAGTGTTTGTCATAAGTAT No data
Right 920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920864848 Original CRISPR CAGTCAGAGCAGAAGGACAC AGG Intergenic
No off target data available for this crispr