ID: 920865789

View in Genome Browser
Species Human (GRCh38)
Location 1:209752424-209752446
Sequence AGGATAGTCCACAGCGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920865789_920865792 27 Left 920865789 1:209752424-209752446 CCAAGGCCGCTGTGGACTATCCT No data
Right 920865792 1:209752474-209752496 GAATGAATAACTTAGACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920865789 Original CRISPR AGGATAGTCCACAGCGGCCT TGG (reversed) Intergenic