ID: 920866295

View in Genome Browser
Species Human (GRCh38)
Location 1:209756680-209756702
Sequence CAGTGTGAACTGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920866295_920866305 11 Left 920866295 1:209756680-209756702 CCCTCTCCCCTCAGTTCACACTG 0: 1
1: 0
2: 5
3: 44
4: 362
Right 920866305 1:209756714-209756736 CCAGGAAGGCCAACCCATGCAGG 0: 1
1: 0
2: 0
3: 17
4: 190
920866295_920866302 -7 Left 920866295 1:209756680-209756702 CCCTCTCCCCTCAGTTCACACTG 0: 1
1: 0
2: 5
3: 44
4: 362
Right 920866302 1:209756696-209756718 CACACTGAGAGCTCTGGGCCAGG 0: 1
1: 0
2: 4
3: 36
4: 372
920866295_920866303 -3 Left 920866295 1:209756680-209756702 CCCTCTCCCCTCAGTTCACACTG 0: 1
1: 0
2: 5
3: 44
4: 362
Right 920866303 1:209756700-209756722 CTGAGAGCTCTGGGCCAGGAAGG 0: 1
1: 0
2: 3
3: 59
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920866295 Original CRISPR CAGTGTGAACTGAGGGGAGA GGG (reversed) Intronic
900724833 1:4209077-4209099 CAATGTGAATTCAAGGGAGAAGG - Intergenic
900930384 1:5733469-5733491 GTGTGTGGACTGATGGGAGACGG - Intergenic
902972416 1:20063402-20063424 CAGTGGAAACTGTGGGGAGAGGG + Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904692232 1:32302047-32302069 TAGTGTGAATTGAAGGTAGAGGG + Intronic
905510159 1:38513008-38513030 GTGTGTGAAGTGAGTGGAGAGGG + Intergenic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907823982 1:57997687-57997709 AAGTGGGGTCTGAGGGGAGAAGG + Intronic
908432373 1:64071687-64071709 GAGTGGCAACTGCGGGGAGAAGG + Intronic
911857719 1:102902075-102902097 CAGTGTGAGTTGATGAGAGAGGG + Intronic
913093974 1:115498754-115498776 GAGTGAGCACTGAGGGGTGAGGG - Intergenic
913612600 1:120523179-120523201 GAGTGAGAGCTGAGAGGAGAGGG + Intergenic
914578591 1:148999069-148999091 GAGTGAGAGCTGAGAGGAGAGGG - Intronic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917169804 1:172158509-172158531 CAGTGTGCAGTGAGAAGAGAGGG + Intronic
917732660 1:177891709-177891731 CACTGTGATCTCAGGGGAGCAGG - Intergenic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918064961 1:181094121-181094143 GAGTGTGAAGTGAGAGGAAATGG + Intergenic
918450140 1:184649956-184649978 ATGTGTGTACTGAGGGGACAGGG + Intergenic
919987833 1:202688279-202688301 AAGTGTGAAATGAGAGGATATGG + Intronic
920340749 1:205273815-205273837 CTGTGTGAACTGCCGGGAGTGGG - Intergenic
920657527 1:207887815-207887837 CAGTGTGAACCGAGGGGCTCAGG - Exonic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921601010 1:217106484-217106506 CAGTGTGAATTGAGATGACAGGG + Intronic
921968839 1:221122592-221122614 GAGTGTGAACTGAGAGGATGTGG + Intergenic
922162377 1:223088207-223088229 GAGTGTGGAGTGAGGGGAGGAGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923193611 1:231643294-231643316 CAGTGAGATCTGAAGGGACAAGG - Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1062823337 10:550940-550962 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823354 10:551022-551044 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1065777321 10:29132918-29132940 CAGTGTGAGCTGATGGGAAGAGG - Intergenic
1067270331 10:44786086-44786108 CATTGAGAAGTGTGGGGAGAAGG - Intergenic
1070001487 10:72381285-72381307 CAAGGTTAAGTGAGGGGAGATGG + Intronic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070288721 10:75101076-75101098 CAGTGAGGAGTGTGGGGAGAAGG + Intronic
1070414576 10:76177746-76177768 CAATGAGGATTGAGGGGAGAGGG + Intronic
1070822810 10:79372360-79372382 GATTGGGAAGTGAGGGGAGAGGG + Intergenic
1072809980 10:98453966-98453988 CAGGGTGTTCTGTGGGGAGAGGG - Intergenic
1074964916 10:118482109-118482131 CAGTGTGACCTGGGAGGAAATGG - Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1077239859 11:1504846-1504868 GAGGGTGAACTGAGGGGAAGGGG + Intergenic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077793786 11:5469457-5469479 CTGGGTGAATTGAGGTGAGATGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1084285362 11:68127832-68127854 CAGGGCTGACTGAGGGGAGAGGG - Intergenic
1084900041 11:72302790-72302812 CAGTGTGGACTGTGGTGCGAGGG + Intronic
1085555866 11:77421139-77421161 CAGGGTGAGATGAGGGGAGGAGG - Intronic
1086771962 11:90777376-90777398 CAGTGTGAACTGGGAGGATTTGG - Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1088124236 11:106404489-106404511 CATGGTGAAATGAGGGGAGTTGG - Intergenic
1088145251 11:106669226-106669248 CAGTGTGGACTGATGGGCGTTGG + Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089975621 11:122729208-122729230 CAGTGGGAACTGCAGGGAGCTGG - Intronic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1096083644 12:48850462-48850484 AAATCTGAACTTAGGGGAGAGGG + Intronic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1097194639 12:57236716-57236738 GACTGGGAACTGCGGGGAGAGGG - Intronic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097472673 12:60014675-60014697 GAGTGTGCACTGGGGAGAGATGG + Intergenic
1097589785 12:61560673-61560695 CATTCTGAATTGAGGGGATAAGG + Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1100451806 12:94713731-94713753 CAGTGGGAAGTGTGTGGAGAAGG + Intergenic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101893718 12:108738562-108738584 TAGTGAGAAGTGGGGGGAGAGGG - Intergenic
1102079450 12:110086177-110086199 CAGTAGGAACTGGGGTGAGAAGG + Intergenic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104155559 12:126127861-126127883 CAGTGTGTACTGCTGGGTGATGG + Intergenic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1106123076 13:26878010-26878032 CAGGGTGAACTGAATGGTGAAGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107879166 13:44817917-44817939 CTGAGTGAAGTGAGTGGAGAGGG + Intergenic
1108584891 13:51862649-51862671 CAGTCTGAGCTTAGGAGAGATGG + Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1113881191 13:113627592-113627614 AAGTGTGCACTTAGGGCAGAAGG + Intronic
1114409810 14:22490060-22490082 CATTCTCAACTGAGAGGAGAGGG + Intergenic
1115238257 14:31229077-31229099 CACTGTGTACAGAGGGGACATGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119030465 14:71188331-71188353 CAGTGTGCAGTGAAGGGAGCTGG + Intergenic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120286201 14:82505188-82505210 CAGTGTGAAGTATGGGGAGGGGG - Intergenic
1120287659 14:82524838-82524860 CTTTGTGAACTCAGGGGAAAGGG + Intergenic
1120333900 14:83128873-83128895 CAGGTTGAACTGAGAGGAAATGG - Intergenic
1120702901 14:87717496-87717518 CAGAGTGAACTGGGAGGTGAGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121656856 14:95603437-95603459 CAGGTTGAGTTGAGGGGAGAAGG + Intergenic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122744080 14:103887783-103887805 CAGCCCGAGCTGAGGGGAGAGGG - Intergenic
1123043954 14:105502494-105502516 CAGTGTGGACTGAGCGGTCAGGG - Intergenic
1124004651 15:25786063-25786085 CAGGGAGAAGTGTGGGGAGAAGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1128079424 15:64847427-64847449 GAGTGTGAAGTGGGGGGTGAAGG - Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1129613588 15:77081275-77081297 CCCTGTAACCTGAGGGGAGAAGG + Intronic
1129907117 15:79196124-79196146 CACCCTGAACTCAGGGGAGAGGG + Intergenic
1129907285 15:79197339-79197361 CAGGGTGAACTGGGTGGACAGGG + Intergenic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1131515625 15:93074378-93074400 AAGTTTGAAGGGAGGGGAGAAGG + Intronic
1131561159 15:93441370-93441392 CAGTGAGAACTGAGTGTATATGG + Intergenic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1133188668 16:4117200-4117222 CACTGTGGAGTGTGGGGAGAAGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138837873 16:60460040-60460062 CAGAGAGAACTGAGGGTAGTTGG - Intergenic
1139235924 16:65339003-65339025 CACTGTGAACTGTGGTAAGATGG + Intergenic
1139432755 16:66919846-66919868 GAGTCTGGAATGAGGGGAGAGGG + Intergenic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1141638755 16:85329282-85329304 GTGTGTGAAGTGAGTGGAGAAGG + Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142169600 16:88614839-88614861 CAGTGGGGTCTCAGGGGAGAAGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142700941 17:1660366-1660388 CAGGTGGAATTGAGGGGAGAGGG - Intronic
1142959775 17:3545263-3545285 AAGTGTGCACTGAGGGAACACGG + Exonic
1143002362 17:3802649-3802671 CAGAATGAAGTGAGGGGAGGAGG - Intergenic
1147109622 17:38252407-38252429 CAGTGTAAAGGGAGGGGACAGGG + Intergenic
1147156844 17:38548373-38548395 CACTGTGAAATGAGGGGTGGGGG - Intronic
1147202168 17:38809998-38810020 CAGCATGAAGTGAGAGGAGAAGG - Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147728130 17:42579549-42579571 CACTGTGAACTGAGGAGGGGAGG - Exonic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148419827 17:47535660-47535682 CAGTGTAAAGGGAGGGGACAGGG - Intronic
1148587902 17:48794001-48794023 CAGGTGGAACTGAGGAGAGATGG + Intronic
1149299647 17:55293355-55293377 CACTGTGCTCTGAGGAGAGAAGG + Intronic
1150343449 17:64386935-64386957 GAGTGTGAACTTAGGGGAGGAGG + Intronic
1150431013 17:65117348-65117370 CAGTGTGAAATGAGGAGAAAGGG - Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152356213 17:79808946-79808968 CAGTCTAAACTGCGCGGAGAAGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152719145 17:81914383-81914405 CATTGTGCACTTTGGGGAGAGGG - Exonic
1153877152 18:9384177-9384199 AAATGGGAACTGAGGGGTGATGG + Intronic
1154004176 18:10512670-10512692 CAGGGAGAACTCAGGAGAGAGGG - Intergenic
1155320524 18:24614324-24614346 CAGTGTGAAAGGAAGGGATATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157172283 18:45418885-45418907 CAGTGTCAGAGGAGGGGAGAGGG + Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1158218185 18:55122216-55122238 CAGTGTGAACCAGTGGGAGAAGG + Intergenic
1158413662 18:57230862-57230884 CAGTATGAAGTGAAGGCAGAGGG - Intergenic
1159095753 18:63899632-63899654 CAGTGGGATCTTAGGGGAGCCGG - Intronic
1159605308 18:70468756-70468778 CTGCATGAACTGAGGGGAAAAGG + Intergenic
1159791660 18:72788866-72788888 CATTTTGATATGAGGGGAGAGGG - Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160292413 18:77606882-77606904 CATTGGGAACTGAGGTGTGATGG + Intergenic
1162500216 19:11049131-11049153 CAGTGTCCACTGGGAGGAGAGGG + Intronic
1163029500 19:14534999-14535021 CAGTGTGGACTGCTGGGAGAGGG + Intronic
1165157732 19:33798039-33798061 CGGTGTGAACTTAGGGGCGACGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166982287 19:46638591-46638613 GAGTGTGTACTGCCGGGAGACGG - Intergenic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167744546 19:51342850-51342872 CAGTGAGAACTAGGGGGAGGAGG - Intergenic
925383651 2:3446661-3446683 CAGTGGGCACTGCGGGGACATGG + Intronic
925461376 2:4066148-4066170 CAGTGTGATCTGAGCTGAGTTGG + Intergenic
925708407 2:6713331-6713353 CAGTGTGAACTGAATGGACCAGG - Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929945468 2:46368348-46368370 CATAGGGAACTGAGGGGAGAGGG + Intronic
931037273 2:58257636-58257658 AACTGTGAACTGAGGGGAGAGGG + Intergenic
931424197 2:62156221-62156243 GAGTGTGCAGTGAGCGGAGATGG - Intergenic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
932454024 2:71834709-71834731 GAGGGTGAACTGAGGGGCAAAGG + Intergenic
932580351 2:72989258-72989280 AGGTGTGAACTGAGCGGAGGAGG - Intronic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
933933638 2:87180959-87180981 CTGTATGAACTGCGGGGATAGGG + Intergenic
934660512 2:96141067-96141089 CAGTGTGAACTGGGCAGAGCCGG - Intergenic
936359473 2:111784485-111784507 CTGTATGAACTGCGGGGATAGGG - Intronic
940376168 2:152961489-152961511 GAGTGTGAACTGTGAGGAGCTGG + Intergenic
940673291 2:156697048-156697070 CAGTATGAACTGAGTGGTGTTGG + Intergenic
941041552 2:160629037-160629059 CAGTCTCAGCTGAGGTGAGAGGG - Intergenic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
943467088 2:188241040-188241062 CAGGGTGAAGTGATGGGACAGGG + Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
948578048 2:238966635-238966657 CCGTGTGAAACGAGGGGACAGGG + Intergenic
948856482 2:240732689-240732711 CAGGGTGAAATGAGGGGATGAGG + Intronic
948880670 2:240855759-240855781 GACTGTGACCTGTGGGGAGAGGG - Intergenic
1169277863 20:4245698-4245720 CAGTGTGAACCGAGGGGCAGGGG + Intronic
1170405971 20:16037133-16037155 CATTGTGAAGTGAGGTTAGAAGG + Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171188570 20:23141775-23141797 GAGTGTGATCTGAGGGGAGGTGG + Intergenic
1171950342 20:31415819-31415841 CAGTGTGAACTGAGGAGTGGTGG + Intergenic
1172029415 20:31971190-31971212 CAGTGTGTATTGTGGGGAAAAGG + Intronic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1175279520 20:57793812-57793834 CAGTGAGAACTGAAGAGAGGCGG + Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1177785762 21:25669524-25669546 CAATGTGAAGTGAGGGGAGAGGG + Intronic
1180262243 21:46679971-46679993 CAGTGTGGACTGAGGGGTCTTGG - Intergenic
1181406724 22:22690215-22690237 CAGTGAGAAGTGAGTGGACAGGG + Intergenic
1181892915 22:26080075-26080097 GAATGTCAACTGAGGAGAGAAGG - Intergenic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1183600981 22:38840537-38840559 CAATCAGAACTGGGGGGAGAGGG + Intronic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
1184606614 22:45578064-45578086 CATTGTGAACTGGGAGGAGTGGG + Intronic
1184672948 22:46025158-46025180 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184672975 22:46025297-46025319 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184673022 22:46025520-46025542 CAGCGTGCACTGCAGGGAGAGGG - Intergenic
1184673040 22:46025625-46025647 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185125419 22:49008043-49008065 CAGAGTGCAGTGAGAGGAGAGGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185391046 22:50562086-50562108 GAGTGTGCAGTGAGGGGAGCGGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949592447 3:5508640-5508662 CAGTGATAAGTGAGGGGTGATGG + Intergenic
950126270 3:10511625-10511647 CAGTGGGATCTGAGTGGAGTTGG - Intronic
950149046 3:10671958-10671980 CAGTTTGCACTGTGGGCAGAGGG + Intronic
951006969 3:17628460-17628482 CATGGTGAAGTGGGGGGAGAGGG - Intronic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
951445377 3:22773812-22773834 CACTGGGAACTGAGGTGGGAGGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
953267909 3:41411113-41411135 CAATGTGAACTAGGGGTAGAAGG + Intronic
954036996 3:47856194-47856216 CCATGTGAGCTGAGAGGAGATGG - Intronic
954143784 3:48623974-48623996 CAGCATGAGCTGAGGTGAGAGGG - Intergenic
955698554 3:61660507-61660529 CTATGTGAACAGAGGCGAGAGGG - Intronic
955862978 3:63352141-63352163 TGGTGTGCACTGAGGGGAGAGGG + Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956314167 3:67915386-67915408 CAGTGTGGACGGATGGGACAGGG + Intergenic
957037093 3:75303590-75303612 GACTGAGAGCTGAGGGGAGAGGG - Intergenic
957336330 3:78833795-78833817 CAGAAAGAACTGAGGGGTGAGGG + Intronic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
958898192 3:99853911-99853933 CAGTGAGAACTGAGAGCAGGAGG + Intronic
959100359 3:102002767-102002789 AAGTATGTACTGAGGGGAGGGGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960941859 3:122940107-122940129 CAGGCTGGACTGTGGGGAGAGGG - Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961800152 3:129441291-129441313 CCGTGTGAGATGAGGAGAGACGG - Intronic
962189852 3:133299019-133299041 AAATCTGAACTGTGGGGAGAAGG + Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
965916139 3:173848414-173848436 CAGTTTGAAATGAGTGGAAAGGG - Intronic
968107843 3:196014918-196014940 CAGTGTGGACTGAGGGGTCTTGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
969389845 4:6884284-6884306 CATTGTGAACTGAAGAGAAATGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
975597462 4:76063063-76063085 AAGTGTGAAGTGTGGGGAGTTGG - Intronic
975779789 4:77825991-77826013 CAGGTGGAACTAAGGGGAGAAGG + Intergenic
977845896 4:101766470-101766492 CAGAGAGGATTGAGGGGAGATGG - Intronic
981582569 4:146264830-146264852 CAGTGAAAACTGAGGGGAAAAGG - Intronic
985469778 5:32985-33007 CAGTGTGGACTGAGGGGTCTTGG + Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985859130 5:2456544-2456566 CAGAGTGACCTGATTGGAGAGGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
987946111 5:24610736-24610758 CTATGTGCACTGAGGGGATAGGG + Intronic
988385653 5:30561231-30561253 CCTTGTGAACTCAGGGGAAAGGG + Intergenic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
993688141 5:90966228-90966250 CAGTGGGAACTTTGAGGAGAGGG + Intronic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
997101318 5:130972119-130972141 CAGTGTGAACAAAAGGGATATGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
999228781 5:150049178-150049200 CAGAGTGAGCTGAGAGGAGGGGG + Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
999830856 5:155318049-155318071 CAGAGTGAAGTGAGTGGATAAGG - Intergenic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002968255 6:1989406-1989428 GAGTTTGCTCTGAGGGGAGAGGG + Intronic
1003467997 6:6399726-6399748 CAGGGTGAACTCATGTGAGATGG - Intergenic
1004661810 6:17717410-17717432 GAATGTGACCTGAAGGGAGAAGG + Intergenic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1008200965 6:48590112-48590134 CAGTTTGAAGTGAAGTGAGAGGG - Intergenic
1009935184 6:70225370-70225392 CTGTGTCAACTGAGGTGACAGGG - Intronic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1015111429 6:129596225-129596247 TAGTGTGAAATGAGGTCAGAGGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1017979779 6:159390565-159390587 GATTGAGAACTGAGGGGAGCAGG + Intergenic
1018824333 6:167397859-167397881 CAGTGGGAACTGGGCGGACAGGG - Intergenic
1022057052 7:26748036-26748058 CAGTTTTAAATGAGTGGAGAAGG - Intronic
1022590912 7:31661836-31661858 GAATGTGAACTGAAGGGAGTAGG - Intergenic
1024014314 7:45297080-45297102 CAGTGTGAGCTTAAAGGAGAGGG - Intergenic
1024056070 7:45660518-45660540 CTCTGTGAACTGAGGGGTGCTGG + Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026561329 7:71452702-71452724 CAGTATGAACTGAGCAGAGCAGG + Intronic
1026781406 7:73270238-73270260 GAGTGACAACTGAGGGGTGAGGG + Intergenic
1027022263 7:74823684-74823706 GAGTGACAACTGAGGGGTGAGGG + Intronic
1027065755 7:75122238-75122260 GAGTGACAACTGAGGGGTGAGGG - Intronic
1027237010 7:76304022-76304044 CAGTGTGCCCTCAGGGGACAGGG - Exonic
1027549096 7:79568369-79568391 TAGTGTGAAATGCGGAGAGAAGG + Intergenic
1028407059 7:90486595-90486617 CAGTGAGCAGTGTGGGGAGAGGG + Intronic
1028489796 7:91398615-91398637 CAGAGTGCCCTGAAGGGAGATGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029129245 7:98317704-98317726 TGGTGTGAACTGCGGGGTGATGG - Intronic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1029634664 7:101775938-101775960 TATTGTGAAATGAGGGAAGATGG - Intergenic
1031110749 7:117605665-117605687 CAATGAGAGCTGAGGGGAAAGGG + Intronic
1031383204 7:121113629-121113651 TAGGGTGGACTGAGGTGAGAGGG + Intronic
1033529917 7:142251490-142251512 CAGGGTGAAGTGAAGAGAGAAGG + Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1037703491 8:21295988-21296010 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037703498 8:21296012-21296034 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1038026039 8:23591642-23591664 CAGTGAGAACATAGGGGAAAGGG + Intergenic
1038104121 8:24414273-24414295 CAGTGAGAAATCAGAGGAGAGGG + Intergenic
1039208664 8:35186177-35186199 CAGTCTCAACTGGGGGCAGAAGG + Intergenic
1040413987 8:47181301-47181323 CAGTGGGAACAGTGTGGAGAAGG - Intergenic
1042363726 8:67912083-67912105 CAGTGTGAACCCAGAGGAGTGGG - Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1047537359 8:125732032-125732054 CAGTGAGCACTGAGAGGAGGGGG + Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048353144 8:133632108-133632130 CAGTCAGAAATGAGGTGAGAGGG - Intergenic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1049391840 8:142375608-142375630 CAGTGTGCACTGTGGTGAGCTGG - Intronic
1049702198 8:144020400-144020422 GAGAGGGCACTGAGGGGAGAGGG - Intronic
1049702496 8:144021510-144021532 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702703 8:144022357-144022379 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1051397091 9:16634843-16634865 CAGTGTACACTGAGGGGAGGGGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1053292790 9:36892969-36892991 CACTGTTAACTTTGGGGAGAGGG + Intronic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1053536276 9:38929548-38929570 CAGTGTTCACTGAGGGGATGGGG - Intergenic
1054629859 9:67434400-67434422 CAGTGTTCACTGAGGGGATGGGG + Intergenic
1054743688 9:68833511-68833533 CTGTCAGAACTGAGGGGAGTAGG + Intronic
1055054117 9:72008010-72008032 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1055754299 9:79541201-79541223 GGGCATGAACTGAGGGGAGATGG + Intergenic
1056341870 9:85642631-85642653 AATTGTAAAATGAGGGGAGATGG - Intronic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1057283528 9:93729436-93729458 CAGAATGAACTGATGGGACAGGG - Intergenic
1057604506 9:96489418-96489440 CAGTGTGACCTGATGGGGGCGGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060270628 9:122138360-122138382 GTCTGTGAACTGAAGGGAGATGG - Intergenic
1060455759 9:123794253-123794275 CAGTGTACAGTGAGGGGAAAGGG + Intronic
1060551745 9:124488885-124488907 CAGGCTGAGTTGAGGGGAGAAGG - Intronic
1061003384 9:127915257-127915279 CCGTGTGAACTTACGGGAGGGGG + Intronic
1061375376 9:130220870-130220892 CAGAGTGGACTGTGGGGAGGAGG + Intronic
1185797802 X:2981716-2981738 CAGGGTGCACTGATGCGAGAGGG - Intergenic
1186344409 X:8676992-8677014 CAGTGTGGTCTCAGGCGAGAGGG - Intronic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190262834 X:48808475-48808497 CAGAGTGAAATTAGGAGAGATGG - Intronic
1190330779 X:49234034-49234056 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1192035669 X:67560283-67560305 GAATCTGAACTGGGGGGAGAAGG - Intronic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1195645461 X:107226345-107226367 CAGTGAGAGCTTTGGGGAGAGGG - Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196759925 X:119191778-119191800 AAGTTTGCACTGAGGGGAGGGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197716113 X:129707109-129707131 CAGTGTGCAATGAGAGGAGAAGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199677357 X:150199592-150199614 CACTGTGGACTCAGGGGAGAGGG - Intergenic
1200816407 Y:7537794-7537816 CAGTGAGAACTGAGCTGAGAAGG - Intergenic
1201423320 Y:13822749-13822771 CAGTGTGGTCTCAGGTGAGAGGG + Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic