ID: 920867536

View in Genome Browser
Species Human (GRCh38)
Location 1:209765543-209765565
Sequence TGTAGTCTTAGGAACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76053
Summary {0: 1, 1: 5, 2: 389, 3: 7460, 4: 68198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920867532_920867536 -2 Left 920867532 1:209765522-209765544 CCAGGTACATTGGCATGCACCTG 0: 1
1: 14
2: 184
3: 1343
4: 9266
Right 920867536 1:209765543-209765565 TGTAGTCTTAGGAACTCAGGAGG 0: 1
1: 5
2: 389
3: 7460
4: 68198
920867529_920867536 29 Left 920867529 1:209765491-209765513 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 920867536 1:209765543-209765565 TGTAGTCTTAGGAACTCAGGAGG 0: 1
1: 5
2: 389
3: 7460
4: 68198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920867536 Original CRISPR TGTAGTCTTAGGAACTCAGG AGG Intronic
Too many off-targets to display for this crispr