ID: 920868970

View in Genome Browser
Species Human (GRCh38)
Location 1:209777344-209777366
Sequence CCTTACAGGGAGCAGATAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920868957_920868970 16 Left 920868957 1:209777305-209777327 CCCCAACACTGACCTCCTTCTAT 0: 1
1: 0
2: 0
3: 28
4: 246
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868956_920868970 19 Left 920868956 1:209777302-209777324 CCACCCCAACACTGACCTCCTTC 0: 1
1: 0
2: 2
3: 35
4: 473
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868959_920868970 14 Left 920868959 1:209777307-209777329 CCAACACTGACCTCCTTCTATAT 0: 1
1: 0
2: 0
3: 14
4: 230
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868950_920868970 30 Left 920868950 1:209777291-209777313 CCCCCCAACCTCCACCCCAACAC 0: 1
1: 0
2: 23
3: 247
4: 2927
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868954_920868970 26 Left 920868954 1:209777295-209777317 CCAACCTCCACCCCAACACTGAC 0: 1
1: 1
2: 1
3: 85
4: 788
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868953_920868970 27 Left 920868953 1:209777294-209777316 CCCAACCTCCACCCCAACACTGA 0: 1
1: 0
2: 2
3: 59
4: 449
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868951_920868970 29 Left 920868951 1:209777292-209777314 CCCCCAACCTCCACCCCAACACT 0: 1
1: 0
2: 8
3: 135
4: 986
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868952_920868970 28 Left 920868952 1:209777293-209777315 CCCCAACCTCCACCCCAACACTG 0: 1
1: 0
2: 4
3: 89
4: 862
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868958_920868970 15 Left 920868958 1:209777306-209777328 CCCAACACTGACCTCCTTCTATA 0: 1
1: 0
2: 0
3: 15
4: 221
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868962_920868970 1 Left 920868962 1:209777320-209777342 CCTTCTATATTGGCCCTTCCTCC 0: 1
1: 0
2: 2
3: 14
4: 211
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868955_920868970 22 Left 920868955 1:209777299-209777321 CCTCCACCCCAACACTGACCTCC 0: 1
1: 0
2: 4
3: 48
4: 777
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
920868961_920868970 4 Left 920868961 1:209777317-209777339 CCTCCTTCTATATTGGCCCTTCC 0: 1
1: 0
2: 3
3: 15
4: 134
Right 920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920868970 Original CRISPR CCTTACAGGGAGCAGATAGC AGG Exonic
900288802 1:1915094-1915116 CCATTCAGGGAGGAGACAGCAGG - Exonic
900653261 1:3741781-3741803 TCTTACAGGGAAGAGATTGCAGG + Intergenic
903681965 1:25103252-25103274 GCTTCCAGGGAGCAGGGAGCTGG - Intergenic
909238832 1:73185498-73185520 GCTTACAGACAGCAGATAGTGGG + Intergenic
910260974 1:85293627-85293649 CCTCACATGGAGGAGAAAGCAGG - Intergenic
910791391 1:91054745-91054767 CCTTACAGGCAGCAGCCAGATGG + Intergenic
913588013 1:120295329-120295351 TCTTAAAGGCAGCAGATAGTTGG + Intergenic
913620172 1:120603040-120603062 TCTTAAAGGCAGCAGATAGTTGG - Intergenic
914570029 1:148907202-148907224 TCTTAAAGGCAGCAGATAGTTGG + Intronic
914602800 1:149223067-149223089 TCTTAAAGGCAGCAGATAGTTGG - Intergenic
915597610 1:156904464-156904486 CCATACAGGGAGGAGAGGGCAGG + Intronic
918435773 1:184511350-184511372 GCTTTCTGGTAGCAGATAGCAGG + Intronic
919397774 1:197071843-197071865 TCTTAAAGGCAGCAGATAGTTGG - Intergenic
920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG + Exonic
1063439092 10:6057609-6057631 CCTTGCAGGAAGCAGAAAGTGGG - Intronic
1065516394 10:26528233-26528255 CCTGACAGCGAGCAGAGAACTGG + Intronic
1069229636 10:65993653-65993675 TCTTAGAGGCAGCAGATAGTTGG + Intronic
1069397464 10:68005447-68005469 CTTTGCAGGGAGCAGATCACTGG + Intronic
1069604018 10:69728763-69728785 CTGTGCAGGGAGCAGAGAGCTGG + Intergenic
1069925345 10:71846608-71846630 CCTCCCAGGTAGCTGATAGCTGG - Intronic
1070983586 10:80669437-80669459 CCATACAGGTAGCAGAGAGAAGG - Intergenic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1073407627 10:103311759-103311781 CCTAAGAGGGAGCAGAAACCTGG + Intronic
1073974703 10:109087329-109087351 CCTTATGGGAAGCAGTTAGCTGG - Intergenic
1074575193 10:114662442-114662464 ACTTACGGGGAGCAGGGAGCAGG - Intronic
1077826267 11:5811800-5811822 CCTCACAGGCAGCAAATAGTTGG - Intronic
1081904347 11:46657780-46657802 CCTAAGAGGGAGCAGAAAGAAGG - Intronic
1084690910 11:70726037-70726059 GCTTACATGGAGGAGAGAGCTGG - Intronic
1086003795 11:82012044-82012066 CCTTCCTGGGAGTAGATAGCTGG + Intergenic
1089001220 11:115053982-115054004 CCTTGCAGACAGCAGATCGCAGG - Intergenic
1090109623 11:123892303-123892325 CCTTAGAGAGAGCAGATGGCTGG + Intergenic
1091714107 12:2764770-2764792 CCTTGGAGGGAGCAGAGAGGAGG + Intergenic
1095570430 12:43677915-43677937 CCTTGTAGGCAGCAGATAGTTGG - Intergenic
1095641604 12:44492428-44492450 CCTTACAGAGAGCAGATCCAAGG - Intergenic
1101318562 12:103652333-103652355 CCTTCCAGGGAGTAGAAACCTGG - Intronic
1103132335 12:118480181-118480203 CCTTACAAGGAGCAGTTTACGGG - Intergenic
1104076836 12:125397326-125397348 CCTGACAGGTAGCAGATACTTGG + Intronic
1104310541 12:127650905-127650927 GGTTACAGGGAGAAGACAGCAGG - Intergenic
1104440465 12:128789575-128789597 CCTGACAGGTTGCAGACAGCTGG - Intergenic
1104470883 12:129028745-129028767 CCTAACAGGGAGTGGATAGGGGG - Intergenic
1105328954 13:19396547-19396569 CAACACAGGGAGCAGAAAGCAGG - Intergenic
1110793470 13:79611154-79611176 TCTTAAAGGCAGCAGATAGTTGG + Intergenic
1113062830 13:106342491-106342513 CCTTAGAGAGAGCAAAGAGCAGG + Intergenic
1113269756 13:108660685-108660707 TCTTGAAGGCAGCAGATAGCTGG + Intronic
1114802801 14:25797497-25797519 CCTTATTGGGAGCAGACAGTGGG + Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1120500945 14:85296734-85296756 CCTTAAATGTAGCAGATATCTGG - Intergenic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1126218117 15:46180974-46180996 TCTTATAGGCAGCATATAGCTGG + Intergenic
1126654368 15:50959861-50959883 TCTTATAGGCAGCATATAGCTGG - Intronic
1128086360 15:64889217-64889239 CCCTAGAGGGACCAGATAGGAGG + Intronic
1131658268 15:94484930-94484952 CCCTACAGGTAGCAGGCAGCTGG - Intergenic
1132159625 15:99526940-99526962 TCTTACAGGCAGCATATACCTGG + Intergenic
1132289232 15:100687883-100687905 CCTTGCAGGAAGCAGAGAACAGG + Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1133543626 16:6783142-6783164 CCTTATAGGCAGCATATAGTTGG + Intronic
1135303370 16:21349565-21349587 GCTTCCAGGGTGCACATAGCAGG + Intergenic
1135655921 16:24249484-24249506 CCTTCCAGGGGGCAGAGAGTAGG - Intergenic
1142061849 16:88035529-88035551 GCTTCCAGGGTGCACATAGCGGG + Intronic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1148093875 17:45039230-45039252 CCTGACAGGGAGCTGCTGGCAGG - Intronic
1151288165 17:73128481-73128503 CCTTACATGGGGCAGATATGAGG + Intergenic
1155537629 18:26833339-26833361 CCTAACACCCAGCAGATAGCAGG - Intergenic
1157162094 18:45323391-45323413 ACTTTCAGGGAGGATATAGCTGG - Intronic
1157930515 18:51816564-51816586 CCTTAGTGGGGACAGATAGCAGG + Intergenic
1158413926 18:57232613-57232635 CTTTACAGGGAGCTGTTAGAAGG + Intergenic
1159415550 18:68143425-68143447 TCTTACATGCAGCATATAGCTGG - Intergenic
1160141825 18:76330661-76330683 TCTTACAGGCAGCATATAGTTGG - Intergenic
1164205109 19:23051977-23051999 CCTTCCTGTGAGCAGACAGCAGG + Intergenic
1168403556 19:56099382-56099404 CATTTCATGGAGCAGAGAGCTGG + Intronic
1168458225 19:56532018-56532040 TCATAAAGGCAGCAGATAGCTGG + Intergenic
926385580 2:12332820-12332842 CATTCCAGTGAGCAGAAAGCTGG - Intergenic
926524740 2:13964998-13965020 CCTTATAGGTAGCATATAGTTGG + Intergenic
926528324 2:14010286-14010308 TCTTGCAGGGAGCATATAGATGG - Intergenic
926695982 2:15770490-15770512 CCTAACAGGGAGGAGGGAGCTGG - Intergenic
932434582 2:71695507-71695529 CCTTACCTGGTGCAGATAGGAGG - Intergenic
936068274 2:109348366-109348388 GCTCACAGGGAGATGATAGCTGG + Intronic
936112765 2:109678352-109678374 CCCTGCAGGGAGCAGAAGGCAGG - Intergenic
938139231 2:128782788-128782810 ACTCACAGGGAACACATAGCAGG - Intergenic
942190351 2:173463248-173463270 CCTTTCAGGGAGCAGCTGTCCGG + Intergenic
944400425 2:199319822-199319844 CATAAAAGGGAGAAGATAGCAGG + Intronic
948519540 2:238526858-238526880 CCTTGCAGGGAGCAGACACTGGG - Intergenic
1171102997 20:22403654-22403676 CCTTACAGGAAGCAGAATCCAGG - Intergenic
1171126528 20:22606763-22606785 CCTTTCAGGGATCACATAACTGG - Intergenic
1173364408 20:42371893-42371915 CCTTAGAGGGATCATATGGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175604315 20:60299700-60299722 CCCTGGAGGCAGCAGATAGCAGG + Intergenic
1182754630 22:32668800-32668822 CCTTTCATGGGGCAGATGGCAGG - Intronic
1183092994 22:35536092-35536114 CAGTACAGAGGGCAGATAGCCGG - Intergenic
1183510769 22:38233462-38233484 CCCTGCAGGCAGCAGATAGACGG - Intronic
955410876 3:58654559-58654581 CTTTACAGGGACCGGAAAGCAGG + Intronic
956268587 3:67425700-67425722 CCTTACAGACAGCAGATTGTGGG + Intronic
956428762 3:69163846-69163868 CCTTTCAGGGATCTGATAGTGGG - Intergenic
961685186 3:128625091-128625113 CCTGTCAGGGAGCAGAGAGTGGG + Intronic
963247644 3:143077272-143077294 TCTTACGGGGAACAGAGAGCAGG - Intergenic
963466388 3:145687429-145687451 CCTGACAGGAAGTAGATGGCAGG + Intergenic
968947691 4:3674286-3674308 CATTCTAGGGAGGAGATAGCCGG - Intergenic
969233725 4:5850552-5850574 CCATACAGGCATCAGTTAGCAGG - Intronic
974367173 4:60965127-60965149 TCTTACAGTCAGCAGATCGCAGG - Intergenic
975618595 4:76273025-76273047 CCCTACAGGTAACAGATAACAGG - Intronic
979746894 4:124226780-124226802 TCTTACAGGCAGCAAATAGTTGG - Intergenic
980137710 4:128875677-128875699 CCTTACAGAGAGCATATATTAGG + Intronic
980279669 4:130703531-130703553 CCTTTGTGGGACCAGATAGCAGG + Intergenic
981285767 4:143017456-143017478 TCTTACAGGCAGCAAATAGTTGG + Intergenic
982090210 4:151873833-151873855 CTTTCCAGGGAGCAGATTCCAGG + Intergenic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984053109 4:174891693-174891715 CCTTGCAGAGAGAAGATAGTGGG + Intronic
985133891 4:186766266-186766288 CCTGTTAGGGAGCAGCTAGCAGG + Intergenic
985561116 5:586564-586586 CATTTGAGGGAGCAGTTAGCAGG + Intergenic
985605377 5:855163-855185 CCCTACAGAGAACAGAGAGCCGG + Intronic
986622752 5:9692555-9692577 CCTTACTGGAAGCAGATGGCAGG - Intronic
986753057 5:10807604-10807626 CCTGACAGTGAGAAGATACCTGG + Intergenic
988253083 5:28785851-28785873 CTTTAGAGGAAGCTGATAGCTGG + Intergenic
988777467 5:34490488-34490510 CCTTACAGGTACCAGGTACCAGG + Intergenic
990904863 5:60793012-60793034 CTTTTCATGGAGCAGAGAGCTGG + Intronic
993476673 5:88374629-88374651 CTTTACAGGAAGCACAGAGCTGG + Intergenic
994559526 5:101349490-101349512 CTTTACAGGCAGCAGATGGGTGG - Intergenic
997403893 5:133627647-133627669 TCTTACAGACAGCATATAGCAGG + Intergenic
997580568 5:135014286-135014308 GCTTTCAGAGAGCAGAGAGCTGG + Intergenic
998454800 5:142263529-142263551 GCTTCCAGAGAGCACATAGCAGG - Intergenic
1001290898 5:170458940-170458962 TCTTGAAGGCAGCAGATAGCTGG - Intronic
1002953342 6:1837876-1837898 CCTCACAGGGAGCAGACAGGAGG + Intronic
1006701474 6:35977333-35977355 TGTTACAGGAAGCAGAAAGCTGG + Exonic
1007069127 6:39022377-39022399 GCTCACAGGAAGCAGTTAGCTGG - Intronic
1010164903 6:72904263-72904285 TCTTAAAGGCAGCAGATAGTTGG + Intronic
1010628304 6:78166566-78166588 GATTACAGGGAGAAGACAGCTGG - Intergenic
1011507345 6:88060784-88060806 CCTAACAGGGACGAGATAGTAGG - Intronic
1012603428 6:101127598-101127620 GCTTTCAGGGAGCAGGTAGGGGG - Intergenic
1012690336 6:102302691-102302713 TCTTGCAGGCAGCAGATAGTTGG - Intergenic
1015301416 6:131656702-131656724 GCTTACAGTGAGCAGAGATCAGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018598536 6:165511926-165511948 TCTTACAGGCAGCATATAGTTGG + Intronic
1020761830 7:12277331-12277353 TCTTACAGGCAGCAAATAGTTGG + Intergenic
1021481063 7:21117586-21117608 TCTTACAGGCAGCAGATGGTTGG + Intergenic
1022571385 7:31457450-31457472 ACTTACAGGGAGCAAACAGGGGG + Intergenic
1023816859 7:43957432-43957454 CCTTATAGGCAGCATATAGCTGG - Intergenic
1025718481 7:63986320-63986342 CCTTGCAGGCAGCAGATTGTTGG - Intergenic
1026600270 7:71771808-71771830 GCTTGCAGGGAGCAGATCACAGG + Intergenic
1027140028 7:75650310-75650332 ACTTACAGGGAGGAGCTGGCGGG - Intronic
1031139065 7:117921110-117921132 TCTTAAAGGCAGCAGATAGTTGG - Intergenic
1031412272 7:121454301-121454323 TCTTATAGGGAGAAGATAGTTGG + Intergenic
1034588997 7:152122902-152122924 TCTTACAGGCAGCATATAGTTGG - Intergenic
1034730017 7:153378943-153378965 CCTTCCAGGGAGCAGAGTCCAGG - Intergenic
1035086179 7:156260307-156260329 GTTTACAGGGAGCAGTGAGCGGG - Intergenic
1035449934 7:158970608-158970630 CCTTACAGGGAGCAGTAAGTGGG - Intergenic
1035459492 7:159030278-159030300 GCTTGCAGGGAGCAGAGATCAGG + Exonic
1039689208 8:39845001-39845023 TCTTATAGAGAGCATATAGCTGG + Intergenic
1044291161 8:90472161-90472183 ACTTACAGGTAGCAGATACCCGG + Intergenic
1044795050 8:95888095-95888117 TCTTATAGAGAGCAGATAGAAGG + Intergenic
1046632236 8:116632634-116632656 CCTTACAGGAAAAAGTTAGCTGG + Intergenic
1050877201 9:10653522-10653544 CCTTAAAGACAGCACATAGCTGG - Intergenic
1051210147 9:14732854-14732876 CCTTGCAGGCAGCATATAGCTGG + Intergenic
1051277736 9:15413696-15413718 TCTTGAAGGCAGCAGATAGCTGG + Intergenic
1051533418 9:18130582-18130604 CTTTACAGAGAGAAGCTAGCAGG + Intergenic
1052544259 9:29853241-29853263 CCAAAAAGGGAGCAGGTAGCGGG - Intergenic
1052788542 9:32852582-32852604 CCTCACAGGGAGCACTCAGCTGG - Intergenic
1055300928 9:74881162-74881184 TCTTACAGGTAGCATATAGTTGG - Intronic
1055833225 9:80407537-80407559 CCTTTCAGGGAGCAGTTACATGG + Intergenic
1059641689 9:116223173-116223195 CCTCACTGGGAGCACAGAGCTGG + Intronic
1059745248 9:117193936-117193958 CCATGCAGGGAGCAGAGGGCAGG + Intronic
1062705549 9:137938488-137938510 TCTTAAAGGGAGCAGATGGTTGG - Intronic
1190415776 X:50178931-50178953 CCTTCCATCAAGCAGATAGCTGG - Intergenic
1192219257 X:69186087-69186109 CTTTAAGGGGAGCAAATAGCTGG + Intergenic
1194662627 X:96643527-96643549 TCTTACAGGTAGCAGGCAGCAGG - Intergenic
1194901704 X:99520165-99520187 ACTTACTAGGAGCAGTTAGCTGG - Intergenic
1202602940 Y:26613052-26613074 CAACACAGGGAGCAGAAAGCAGG + Intergenic