ID: 920869078

View in Genome Browser
Species Human (GRCh38)
Location 1:209778302-209778324
Sequence TGACCTCACTTTACAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920869078 Original CRISPR TGACCTCACTTTACAAGAAG AGG (reversed) Intronic
905814328 1:40937141-40937163 AAACATCACTTTACAGGAAGGGG + Intergenic
906375932 1:45296630-45296652 TGACCTCACTTGGCAGAAAGAGG - Intronic
907424585 1:54371590-54371612 TAGCCTCACTTTAGAAGAGGCGG - Intronic
911349882 1:96740300-96740322 TGGCCTCACTTCAAGAGAAGTGG - Intronic
913514522 1:119592189-119592211 TTAGCTTACTTTACAAGAAAAGG + Intergenic
916204401 1:162301295-162301317 TGACCTTATTTTATAAAAAGAGG + Intronic
920456387 1:206104861-206104883 TGACCTCAGTTTAGAAAAAAAGG + Intergenic
920869078 1:209778302-209778324 TGACCTCACTTTACAAGAAGAGG - Intronic
922298646 1:224274907-224274929 TGTCCTCACTTTAAGAGAAAAGG + Intronic
1066013183 10:31212923-31212945 TGCCCTCACCTCTCAAGAAGAGG - Intergenic
1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG + Intronic
1071491385 10:86138953-86138975 TGACGTCTCTTTACAAAAGGTGG - Exonic
1071689213 10:87797721-87797743 TGAGCACAGTTTACAGGAAGTGG + Intronic
1073245186 10:102085176-102085198 AGACATCACTTTACAAAAAAGGG + Intergenic
1077273760 11:1693881-1693903 TGACCTCACAGAACAGGAAGGGG - Intergenic
1089061004 11:115626062-115626084 TGAGCTCACTTCTCAAGAAGTGG - Intergenic
1093165937 12:15804359-15804381 TGCTCTCTCTTTACAAGGAGAGG - Intronic
1095789068 12:46144393-46144415 TGTCTTCACTTTGCAAGAAATGG + Intergenic
1096154118 12:49332414-49332436 CAACCTCACTTTATTAGAAGAGG + Exonic
1097870635 12:64599134-64599156 TGACATGACTTGACAAGTAGTGG + Intergenic
1099118893 12:78663433-78663455 TGACATCACTTTCAAAGTAGAGG - Intergenic
1099449374 12:82790455-82790477 TGAATTCTCTTCACAAGAAGAGG + Intronic
1100522681 12:95390420-95390442 TGAGCACAGTTTACAGGAAGTGG + Intergenic
1101815665 12:108144149-108144171 AGACTTGGCTTTACAAGAAGTGG - Intronic
1104092574 12:125527997-125528019 AGACCACCCTTTTCAAGAAGCGG - Intronic
1104528694 12:129548695-129548717 TGACCTCACCTAACATCAAGGGG + Intronic
1106554388 13:30797635-30797657 TGACCTCACTGTACAGCCAGAGG + Intergenic
1107243195 13:38262267-38262289 TGAAATCACTTTTCAAGAACTGG + Intergenic
1107529761 13:41271990-41272012 TGAGCACAGTTTACAGGAAGTGG - Intergenic
1109911384 13:68916363-68916385 TTTCCTCATTTTAAAAGAAGTGG + Intergenic
1111527101 13:89486649-89486671 TCAGCCCACTTCACAAGAAGAGG + Intergenic
1114668041 14:24392246-24392268 TGTTCTAACTTTACATGAAGAGG - Intergenic
1115243599 14:31272978-31273000 TGAGCACAGTTTACAGGAAGTGG + Intergenic
1115845224 14:37524110-37524132 TGACTTTACCTTACAAGCAGTGG + Intronic
1116593635 14:46811581-46811603 TCACTTCACTTTATAAGGAGAGG - Intergenic
1118392069 14:65304020-65304042 TGACCCCAGGTTACAAGCAGAGG - Intergenic
1120617052 14:86720008-86720030 TGACAGCACTTCACAATAAGTGG - Intergenic
1121051457 14:90821470-90821492 TGTACTCACCTTATAAGAAGTGG - Intergenic
1122528679 14:102408999-102409021 TGACCTCATGTGACAGGAAGTGG + Intronic
1124495201 15:30182108-30182130 TTTCTTCACTTTATAAGAAGGGG + Intergenic
1124748370 15:32356537-32356559 TTTCTTCACTTTATAAGAAGTGG - Intergenic
1126359338 15:47829936-47829958 TGACCACACTTCCCAGGAAGTGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131690059 15:94817262-94817284 TAACCTCTCTTGACAATAAGAGG + Intergenic
1133893060 16:9899967-9899989 TGACCTCACTTTTACAGAAAAGG - Intronic
1137628031 16:49921833-49921855 TGACCTGACTAGACAAGCAGTGG + Intergenic
1138108372 16:54304049-54304071 TCAGCTCACTTTACAGGAAGAGG - Intergenic
1138333063 16:56230773-56230795 TGAACTCAGTTTCCAGGAAGAGG - Intronic
1138792491 16:59922767-59922789 TTACTTCGCTTTACAAGAAGAGG - Intergenic
1138993597 16:62421396-62421418 TAGCCTCACTTTACAAAAAAGGG - Intergenic
1140498655 16:75412717-75412739 TGGCCTCTCATTAGAAGAAGAGG - Exonic
1141950770 16:87338109-87338131 TGACCTCGCTTTACATAAAGAGG + Intronic
1142977591 17:3655124-3655146 GGGCCTCACGTGACAAGAAGGGG + Intronic
1146717626 17:35099749-35099771 TGACCTTCCTTTAAAAGATGTGG + Intronic
1147158442 17:38557310-38557332 TCACCTCTCTTTTCAACAAGGGG - Intronic
1147513070 17:41088983-41089005 TGAGCACAGTTTACAAAAAGTGG + Intronic
1148473414 17:47910748-47910770 TGACATAACTTTAGAAGCAGTGG - Intronic
1148696034 17:49558924-49558946 CGACCTCACCTTAAAAGAGGGGG + Intergenic
1150219579 17:63488583-63488605 TGAGCTCCCCTTACAAGCAGAGG + Intronic
1160308687 18:77768039-77768061 TGAGCTCAATTTTCATGAAGAGG + Intergenic
1164744301 19:30599633-30599655 TGGCCTCCCTTTACAAGACAAGG + Intronic
1167399063 19:49252804-49252826 TGACCACACCTTCCAGGAAGAGG + Intergenic
929008097 2:37415045-37415067 TACCCTCATTTTGCAAGAAGAGG + Intergenic
929805466 2:45141002-45141024 GGAGCTCACGTGACAAGAAGCGG - Intergenic
930373430 2:50533720-50533742 GGAGCTCACTGAACAAGAAGCGG - Intronic
934087515 2:88522504-88522526 CGGCCTCACTTTACAACAACTGG + Intergenic
938624966 2:133098302-133098324 TGGCATCACTTTATAATAAGTGG + Intronic
939707634 2:145475449-145475471 TGACATCACTTTAAAATAATGGG - Intergenic
940795653 2:158074506-158074528 TGACATCACTTTAAAACAACGGG + Intronic
941183761 2:162294564-162294586 TAGCCTCACTTTAAAACAAGGGG - Intronic
944493573 2:200283473-200283495 TCTCCTCATTTTCCAAGAAGGGG + Intergenic
945331320 2:208542434-208542456 TGACCTCACGTAAGAAGCAGAGG + Intronic
945587929 2:211690332-211690354 TGACAGCACTTTACAGTAAGTGG + Intronic
946544918 2:220729489-220729511 ACACCTCACTTTACAAAATGAGG - Intergenic
947210735 2:227706263-227706285 TGTCCTCACCTTAGAAGCAGTGG - Intronic
948320501 2:237064868-237064890 TGACCTCCCTTTAGGAGAACAGG + Intergenic
1169011538 20:2255298-2255320 TGATCTCACATACCAAGAAGAGG + Intergenic
1170336325 20:15274408-15274430 TAACTTCACTTTAGAAGAACAGG - Intronic
1170617336 20:17964577-17964599 TGATCTAACTTTCCAAAAAGTGG - Intronic
1172437017 20:34936478-34936500 TGACCTCACCTTACTAGGAGAGG + Intronic
1177498188 21:21916144-21916166 TGAACTAACTTTACCAGAAGGGG - Intergenic
951398287 3:22198831-22198853 TGATTTCTCTTTAAAAGAAGTGG - Intronic
955485272 3:59428508-59428530 TGGCCTCAGCTTGCAAGAAGAGG + Intergenic
963339582 3:144018844-144018866 TGACCTCACACTTCAAAAAGAGG + Intronic
964611658 3:158621937-158621959 TGAGCACAGTTTACAGGAAGTGG - Intergenic
964669063 3:159205329-159205351 TGTCCTGACTTTACAGGGAGAGG - Intronic
965486504 3:169284922-169284944 TGACCCCACCTTTCAGGAAGTGG + Intronic
968294326 3:197562182-197562204 TGAGCACAGTTTACAGGAAGTGG + Intronic
969184526 4:5465490-5465512 TGAACCCAATTTACAAGAAAGGG - Intronic
971934141 4:33125607-33125629 TTACCTCACCTTACAAAACGTGG + Intergenic
972902532 4:43701946-43701968 TGTCATCACTTTACAATAATGGG - Intergenic
974418324 4:61640045-61640067 TTACCTCCCTCTGCAAGAAGTGG + Intronic
977448549 4:97163476-97163498 TAATCTAACTTTACAAGGAGAGG + Intergenic
978718090 4:111870376-111870398 TGACTTTGCTTTACAAGAAAAGG - Intergenic
980163533 4:129196936-129196958 TTTCCTCATTTTACTAGAAGTGG + Intergenic
980816613 4:137954844-137954866 TGACCACATTTTACTACAAGGGG + Intergenic
981287041 4:143029744-143029766 TGACCTAACATCACAAGTAGGGG + Intergenic
981898154 4:149829218-149829240 TAACATCACTTTACAATAAAGGG + Intergenic
982793485 4:159618712-159618734 TTACTTCACTTAACAAGAAATGG - Intergenic
983465129 4:168077631-168077653 TGACCTTACTTTAGGTGAAGAGG + Intergenic
986186754 5:5449379-5449401 TGACTTCACTTTACAAAAAAAGG + Intronic
993844375 5:92922331-92922353 TAACCTCAAATGACAAGAAGGGG + Intergenic
995438779 5:112166593-112166615 TGACCTCACTTTACATGTTTAGG - Intronic
997890988 5:137676689-137676711 TATCCTCACTTTACAAAATGAGG + Intronic
1000420115 5:161029103-161029125 TAACCTAACTTTAAAAGAACAGG + Intergenic
1000565199 5:162838011-162838033 TCAACTCTCTTTACAAGAAGGGG - Intergenic
1002031028 5:176430604-176430626 TGAGCACAGTTTACAGGAAGTGG - Intergenic
1003017167 6:2477478-2477500 TGACCAGACTTTACAAGTATTGG + Intergenic
1005082616 6:21972090-21972112 TGAGCTACTTTTACAAGAAGGGG - Intergenic
1005295869 6:24426895-24426917 TGACCTCATTTTTCTGGAAGAGG - Intronic
1006735274 6:36268844-36268866 TGACCTCACCTCCCAGGAAGGGG + Intronic
1006884753 6:37371859-37371881 TGCCCTCACCTTTCTAGAAGTGG - Intronic
1008394909 6:50994970-50994992 ATGTCTCACTTTACAAGAAGGGG - Intergenic
1009690859 6:67030768-67030790 TGACCTCACTATTCAATAAATGG - Intergenic
1011389065 6:86831417-86831439 TGAGCTCACTGAACAAGAATAGG - Intergenic
1013858232 6:114601911-114601933 TTACTTCACTTTATAAGTAGAGG + Intergenic
1021343455 7:19491671-19491693 TGAACTCACTTTAGAAAAAAGGG - Intergenic
1022405068 7:30081500-30081522 TGTAATCACTTTCCAAGAAGAGG + Exonic
1022419784 7:30209630-30209652 TCACATCACTTTACAAAAGGGGG + Intergenic
1027361074 7:77410694-77410716 TGATTTCACTTTACAGGAATAGG + Intronic
1033711534 7:143951099-143951121 AGACCTCACTTAACACCAAGGGG + Intergenic
1033825356 7:145183154-145183176 TGAGGTCACTTAACAAAAAGTGG + Intergenic
1036822279 8:11950675-11950697 TGACTTCACTTGACATGCAGAGG - Intergenic
1043337488 8:79194382-79194404 TGACCTCAATTTTCAGTAAGTGG - Intergenic
1043733063 8:83709245-83709267 TAACTTCACTTAACAGGAAGAGG + Intergenic
1044455480 8:92388004-92388026 AGACCTCAGTCTACAACAAGTGG - Intergenic
1046228510 8:111319629-111319651 ATACCCCATTTTACAAGAAGAGG + Intergenic
1048770662 8:137891209-137891231 TCTCCTCACTTTACAAGAAATGG - Intergenic
1051731806 9:20151622-20151644 TGACCCCACTTAACCACAAGTGG + Intergenic
1051883229 9:21861751-21861773 TAACCTCACTTTACAGGAAAGGG + Intronic
1052361799 9:27569905-27569927 TGAACTCTCTTGACAAGATGTGG - Intronic
1055897636 9:81197714-81197736 TGATCTCACATAACATGAAGAGG + Intergenic
1057425474 9:94945760-94945782 TGGCTTCATTTTACAAGAGGAGG - Intronic
1057467711 9:95330813-95330835 TGAACACAGTTTACAGGAAGTGG - Intergenic
1058667276 9:107331705-107331727 TGCTGTCACTTTCCAAGAAGAGG - Exonic
1060607402 9:124928023-124928045 TTTCTTCACTTTACAAGAAAAGG + Intronic
1189044680 X:37577955-37577977 TTACCTCACTTAGCAAGGAGTGG + Intronic
1189516041 X:41714384-41714406 TGAACACACTTTACATGAAGTGG + Intronic
1189551057 X:42094313-42094335 TGAGCACAGTTTACAGGAAGTGG - Intergenic
1189691775 X:43624306-43624328 TGAGCCCAGTTTACAGGAAGAGG - Intergenic
1196772757 X:119311152-119311174 TGAGCACAGTTTACAGGAAGTGG + Intergenic
1197042705 X:121958630-121958652 TGAGCACAGTTTACAGGAAGTGG + Intergenic
1197817191 X:130510310-130510332 TGACCTCACTGTATAAGCAGAGG + Intergenic
1197832187 X:130655417-130655439 TGACTTCACTATACAAGCACTGG + Intronic
1199222900 X:145338010-145338032 TGACCTCACTTTCGTAGAACAGG + Intergenic