ID: 920873169

View in Genome Browser
Species Human (GRCh38)
Location 1:209810842-209810864
Sequence GAGTCACAGGATAGGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873169_920873174 26 Left 920873169 1:209810842-209810864 CCAAACAACCTATCCTGTGACTC No data
Right 920873174 1:209810891-209810913 ATATGGACGCTCTCTGAAACAGG No data
920873169_920873173 9 Left 920873169 1:209810842-209810864 CCAAACAACCTATCCTGTGACTC No data
Right 920873173 1:209810874-209810896 TTGAAATGAGATAGTGGATATGG No data
920873169_920873175 29 Left 920873169 1:209810842-209810864 CCAAACAACCTATCCTGTGACTC No data
Right 920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG No data
920873169_920873172 3 Left 920873169 1:209810842-209810864 CCAAACAACCTATCCTGTGACTC No data
Right 920873172 1:209810868-209810890 GCTGCTTTGAAATGAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873169 Original CRISPR GAGTCACAGGATAGGTTGTT TGG (reversed) Intergenic
No off target data available for this crispr