ID: 920873171

View in Genome Browser
Species Human (GRCh38)
Location 1:209810855-209810877
Sequence TCAAAGCAGCATAGAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873171_920873173 -4 Left 920873171 1:209810855-209810877 CCTGTGACTCTATGCTGCTTTGA No data
Right 920873173 1:209810874-209810896 TTGAAATGAGATAGTGGATATGG No data
920873171_920873175 16 Left 920873171 1:209810855-209810877 CCTGTGACTCTATGCTGCTTTGA No data
Right 920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG No data
920873171_920873172 -10 Left 920873171 1:209810855-209810877 CCTGTGACTCTATGCTGCTTTGA No data
Right 920873172 1:209810868-209810890 GCTGCTTTGAAATGAGATAGTGG No data
920873171_920873174 13 Left 920873171 1:209810855-209810877 CCTGTGACTCTATGCTGCTTTGA No data
Right 920873174 1:209810891-209810913 ATATGGACGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873171 Original CRISPR TCAAAGCAGCATAGAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr