ID: 920873175

View in Genome Browser
Species Human (GRCh38)
Location 1:209810894-209810916
Sequence TGGACGCTCTCTGAAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873171_920873175 16 Left 920873171 1:209810855-209810877 CCTGTGACTCTATGCTGCTTTGA No data
Right 920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG No data
920873169_920873175 29 Left 920873169 1:209810842-209810864 CCAAACAACCTATCCTGTGACTC No data
Right 920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG No data
920873170_920873175 21 Left 920873170 1:209810850-209810872 CCTATCCTGTGACTCTATGCTGC No data
Right 920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873175 Original CRISPR TGGACGCTCTCTGAAACAGG TGG Intergenic
No off target data available for this crispr