ID: 920873659

View in Genome Browser
Species Human (GRCh38)
Location 1:209814975-209814997
Sequence AGTCTTGATGGGTCCTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873659_920873665 13 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873665 1:209815011-209815033 GCCTTGCCAGCTTAATTCCCTGG No data
920873659_920873667 14 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data
920873659_920873668 15 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873668 1:209815013-209815035 CTTGCCAGCTTAATTCCCTGGGG No data
920873659_920873670 23 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873670 1:209815021-209815043 CTTAATTCCCTGGGGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873659 Original CRISPR AGTCTTGATGGGTCCTTCTT TGG (reversed) Intergenic