ID: 920873667

View in Genome Browser
Species Human (GRCh38)
Location 1:209815012-209815034
Sequence CCTTGCCAGCTTAATTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873658_920873667 24 Left 920873658 1:209814965-209814987 CCTTTCGAATCCAAAGAAGGACC No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data
920873661_920873667 3 Left 920873661 1:209814986-209815008 CCCATCAAGACTACGCTGGCCAG No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data
920873662_920873667 2 Left 920873662 1:209814987-209815009 CCATCAAGACTACGCTGGCCAGG No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data
920873656_920873667 30 Left 920873656 1:209814959-209814981 CCTGGGCCTTTCGAATCCAAAGA No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data
920873659_920873667 14 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873667 1:209815012-209815034 CCTTGCCAGCTTAATTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873667 Original CRISPR CCTTGCCAGCTTAATTCCCT GGG Intergenic