ID: 920873668

View in Genome Browser
Species Human (GRCh38)
Location 1:209815013-209815035
Sequence CTTGCCAGCTTAATTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873661_920873668 4 Left 920873661 1:209814986-209815008 CCCATCAAGACTACGCTGGCCAG No data
Right 920873668 1:209815013-209815035 CTTGCCAGCTTAATTCCCTGGGG No data
920873659_920873668 15 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873668 1:209815013-209815035 CTTGCCAGCTTAATTCCCTGGGG No data
920873662_920873668 3 Left 920873662 1:209814987-209815009 CCATCAAGACTACGCTGGCCAGG No data
Right 920873668 1:209815013-209815035 CTTGCCAGCTTAATTCCCTGGGG No data
920873658_920873668 25 Left 920873658 1:209814965-209814987 CCTTTCGAATCCAAAGAAGGACC No data
Right 920873668 1:209815013-209815035 CTTGCCAGCTTAATTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873668 Original CRISPR CTTGCCAGCTTAATTCCCTG GGG Intergenic