ID: 920873670

View in Genome Browser
Species Human (GRCh38)
Location 1:209815021-209815043
Sequence CTTAATTCCCTGGGGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920873662_920873670 11 Left 920873662 1:209814987-209815009 CCATCAAGACTACGCTGGCCAGG No data
Right 920873670 1:209815021-209815043 CTTAATTCCCTGGGGTAGCCAGG No data
920873659_920873670 23 Left 920873659 1:209814975-209814997 CCAAAGAAGGACCCATCAAGACT No data
Right 920873670 1:209815021-209815043 CTTAATTCCCTGGGGTAGCCAGG No data
920873664_920873670 -7 Left 920873664 1:209815005-209815027 CCAGGTGCCTTGCCAGCTTAATT No data
Right 920873670 1:209815021-209815043 CTTAATTCCCTGGGGTAGCCAGG No data
920873661_920873670 12 Left 920873661 1:209814986-209815008 CCCATCAAGACTACGCTGGCCAG No data
Right 920873670 1:209815021-209815043 CTTAATTCCCTGGGGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920873670 Original CRISPR CTTAATTCCCTGGGGTAGCC AGG Intergenic