ID: 920874671

View in Genome Browser
Species Human (GRCh38)
Location 1:209822953-209822975
Sequence GTGGGGAACTGCACAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920874671_920874681 26 Left 920874671 1:209822953-209822975 CCATCCTCTGTGCAGTTCCCCAC No data
Right 920874681 1:209823002-209823024 AATGAGTTTCTTTATCCTCTGGG No data
920874671_920874680 25 Left 920874671 1:209822953-209822975 CCATCCTCTGTGCAGTTCCCCAC No data
Right 920874680 1:209823001-209823023 GAATGAGTTTCTTTATCCTCTGG No data
920874671_920874676 0 Left 920874671 1:209822953-209822975 CCATCCTCTGTGCAGTTCCCCAC No data
Right 920874676 1:209822976-209822998 AAACTTTTCCCTCTTCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920874671 Original CRISPR GTGGGGAACTGCACAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr