ID: 920894673

View in Genome Browser
Species Human (GRCh38)
Location 1:210034694-210034716
Sequence CCTAGCTTCCACTTAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920894670_920894673 28 Left 920894670 1:210034643-210034665 CCAATTTCTATGTTCAGTTTCTA 0: 1
1: 0
2: 3
3: 41
4: 465
Right 920894673 1:210034694-210034716 CCTAGCTTCCACTTAAAAGTGGG 0: 1
1: 0
2: 1
3: 36
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920894673 Original CRISPR CCTAGCTTCCACTTAAAAGT GGG Intronic
901166134 1:7222858-7222880 CCTAGCTTCCTCTTCTACGTGGG + Intronic
901171623 1:7262580-7262602 TATAGCTTCCACCTAAAAGGTGG + Intronic
902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG + Intronic
909184922 1:72475123-72475145 TCTCACTTCCACTTACAAGTGGG + Intergenic
909458135 1:75873636-75873658 CCATGTTTTCACTTAAAAGTGGG - Intronic
911576348 1:99583164-99583186 TTTAGCTTCCACTTATAAGTGGG - Intergenic
911946220 1:104112823-104112845 CTTAGCTCCCACTTGTAAGTGGG + Intergenic
912284495 1:108354618-108354640 CGTAGCTCCCACTTATAAGAGGG - Intergenic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
913038613 1:115000760-115000782 CTTAGCTCCCACTTATTAGTGGG + Intergenic
916555338 1:165889909-165889931 TTTAGCTCCCACTTACAAGTGGG + Intronic
917003560 1:170386849-170386871 TTTAGCTTCCACTTGTAAGTGGG + Intergenic
917144535 1:171874887-171874909 TTTAGCTCCCACTTATAAGTGGG + Intronic
919435626 1:197556117-197556139 GCAAGTTTTCACTTAAAAGTGGG + Intronic
919683515 1:200459159-200459181 CCTGGCTTCCACTTCTAAGATGG - Intergenic
920611136 1:207438903-207438925 CTTAGATCCCACTTATAAGTAGG - Intergenic
920836344 1:209514303-209514325 CCTTGCTTCCTTTTAAAGGTTGG + Intergenic
920894673 1:210034694-210034716 CCTAGCTTCCACTTAAAAGTGGG + Intronic
922069788 1:222180622-222180644 TTTAGCTCCCACTTATAAGTGGG - Intergenic
924839818 1:247697145-247697167 CCCATCTTCCACTAAAAATTAGG - Intergenic
1064867746 10:19900822-19900844 CTTAGCTCCCACTTATGAGTGGG + Intronic
1065664038 10:28039084-28039106 CCTACCTCCCACTTATGAGTGGG + Intergenic
1068372696 10:56138449-56138471 CGTAGCATCCACTTAAAATGGGG - Intergenic
1068406168 10:56592285-56592307 CTTAGCTCCCACTTATGAGTGGG + Intergenic
1069341161 10:67410270-67410292 CCAAGTTTTCACTTACAAGTGGG + Intronic
1076010185 10:126981371-126981393 CCTAGCTTCCGCTGATAAGCTGG - Intronic
1077708156 11:4508586-4508608 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1079959667 11:26907504-26907526 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1080260614 11:30345966-30345988 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1080338282 11:31225295-31225317 CTTAGCTCCCACTTATAAGTGGG - Intronic
1081353225 11:42081144-42081166 CCTATCTCTCAATTAAAAGTTGG + Intergenic
1082638798 11:55629262-55629284 CCCAGCTTCCACCTTCAAGTAGG + Intergenic
1082766883 11:57176177-57176199 CTTAGCTCCCACTTATAAGTGGG + Intergenic
1085887840 11:80541562-80541584 CTTAGCTCCCACATATAAGTAGG - Intergenic
1086055897 11:82646111-82646133 TTTAGCTCCCACTTAGAAGTGGG - Intergenic
1086086621 11:82961908-82961930 CTTAGCTCCCACTTATAAGTGGG + Intronic
1086272900 11:85089351-85089373 TTTAGCTCCCACTTATAAGTGGG + Intronic
1086801699 11:91184081-91184103 GCTAGCTTGCTCTTTAAAGTAGG - Intergenic
1087731457 11:101782889-101782911 TTTAGCTCCCACTTAAAAGGGGG + Intronic
1091031805 11:132196696-132196718 TGTAGCTCCCACTTATAAGTGGG - Intronic
1091849941 12:3687415-3687437 TTTAGCTCCCACTTATAAGTAGG + Intronic
1092183756 12:6463628-6463650 CCTAGCTCCCAGTTAATTGTTGG - Intronic
1093090595 12:14915942-14915964 TTTAGCTCCCACTTAGAAGTGGG - Intronic
1093226991 12:16496694-16496716 TTTAGCTGCCACTTACAAGTGGG + Intronic
1093491810 12:19713561-19713583 CCTACCTTCCACCTTCAAGTAGG + Intronic
1093523506 12:20077495-20077517 CCTCGCATCCCCTTCAAAGTAGG - Intergenic
1093642321 12:21541924-21541946 TTTAGCTCCCACTTATAAGTGGG + Intronic
1093977982 12:25443970-25443992 CTTAGCTCCCACTTATATGTGGG + Intronic
1094098003 12:26729723-26729745 TTTAGCTCCCACTTATAAGTGGG + Intronic
1094098004 12:26729730-26729752 TTTAGCTCCCACTTATAAGTGGG - Intronic
1095535024 12:43235080-43235102 CCTCCCTTCCTATTAAAAGTAGG - Intergenic
1095542515 12:43327322-43327344 CTTAGCTCCCACTTGTAAGTGGG + Intergenic
1098081615 12:66791886-66791908 CTTAGCTCCCACTCAAAAATGGG + Intronic
1098303060 12:69074113-69074135 CTTAGCTCCCACTTATAGGTGGG - Intergenic
1098521327 12:71437998-71438020 CTTAGCTCCCACTTATATGTGGG - Intronic
1099547309 12:84000672-84000694 CTTAGATTCCACTTATAAGTGGG + Intergenic
1099565235 12:84234313-84234335 CTTAGATTCCACTTATAAGTAGG + Intergenic
1100924690 12:99531428-99531450 CTTAGCTTCCAATTATAAGTAGG + Intronic
1102548259 12:113672095-113672117 CCTAGCTGGCACTTAAAAGCTGG + Intergenic
1102726278 12:115068072-115068094 CTTAGCTCCCACTTCTAAGTGGG + Intergenic
1103184619 12:118945829-118945851 CTTAGCTTACATTTAAATGTTGG + Intergenic
1103705938 12:122872434-122872456 CCTAGCTTTTACTTTAGAGTTGG - Intronic
1107167380 13:37298552-37298574 CCTAGATTCCACTCCAAAGAAGG - Intergenic
1107233257 13:38137068-38137090 TTTAGCTCCCACTTATAAGTTGG + Intergenic
1108886157 13:55185040-55185062 CTTAGCTTCCACCTATCAGTGGG - Intergenic
1109508953 13:63343177-63343199 TCAAGCTTCTGCTTAAAAGTGGG + Intergenic
1109678726 13:65717298-65717320 CTTAGCTCCTACTTATAAGTGGG + Intergenic
1109758050 13:66787801-66787823 CCTATATTCCACATAAAAATAGG - Intronic
1110345838 13:74446792-74446814 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1111664845 13:91254186-91254208 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112235043 13:97628345-97628367 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1112875318 13:104030816-104030838 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1113332802 13:109346977-109346999 CTTAGCTCCCACTTATGAGTGGG - Intergenic
1114194244 14:20462895-20462917 ACTAGCTTCCAAGTAGAAGTTGG - Intergenic
1114800111 14:25764521-25764543 TTTAGCTCCCACTTACAAGTGGG + Intergenic
1115456608 14:33611465-33611487 CCTAACTGCCCCTCAAAAGTAGG - Intronic
1117738453 14:58791151-58791173 CCACGTTTTCACTTAAAAGTGGG - Intergenic
1117839006 14:59838168-59838190 GTTAGCTCCCACTTATAAGTGGG + Intronic
1119619492 14:76121225-76121247 CCTCGCTACCACTTACAAATTGG + Intergenic
1120121659 14:80687506-80687528 TTTAGCTCCCACTTACAAGTGGG - Intronic
1120277047 14:82389146-82389168 CCCAGATTCCATTTGAAAGTTGG - Intergenic
1123509151 15:20978596-20978618 CCTAGCTTCCTTTTATAAATTGG + Intergenic
1123566374 15:21552343-21552365 CCTAGCTTCCTTTTATAAATTGG + Intergenic
1123602636 15:21989629-21989651 CCTAGCTTCCTTTTATAAATTGG + Intergenic
1124549700 15:30668107-30668129 CTTAGCTCCCACTTATAACTGGG + Intronic
1125225543 15:37391069-37391091 CTTAGCTCCCACTTATAAGTGGG + Intergenic
1128396182 15:67228902-67228924 TTTAGCTCCCACTTATAAGTGGG - Intronic
1128414425 15:67431408-67431430 TTTAGCTCCCACTTATAAGTGGG - Intronic
1128762658 15:70228001-70228023 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1128878862 15:71224809-71224831 CCTACCTCCCACTTATAAGGAGG + Intronic
1129482367 15:75837855-75837877 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1130338670 15:82980021-82980043 TCTGCCTGCCACTTAAAAGTTGG - Intronic
1130433363 15:83871843-83871865 CCTAGCTTCCATTTACATTTTGG - Intronic
1202974741 15_KI270727v1_random:279431-279453 CCTAGCTTCCTTTTATAAATTGG + Intergenic
1133663978 16:7947161-7947183 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1133901174 16:9976505-9976527 CCAAGCCTCCTCTTTAAAGTTGG + Intronic
1137902732 16:52286778-52286800 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1140592153 16:76366350-76366372 TTTAGCTCCCACTTATAAGTAGG + Intronic
1140609819 16:76584485-76584507 CTTAGCTCCCACTTATAAGTTGG + Intronic
1140878579 16:79176385-79176407 GCTATCTCCCACTGAAAAGTAGG + Intronic
1140949165 16:79799343-79799365 CTTAGATTCCACATACAAGTGGG + Intergenic
1143648074 17:8245073-8245095 TTTAGCTCCCACTTATAAGTGGG - Intronic
1149065473 17:52474261-52474283 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1150057360 17:62030467-62030489 CCTGGCTTCCACATCAAGGTGGG + Intronic
1150928384 17:69558140-69558162 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1151174348 17:72274909-72274931 CCTTGCTTCAAATTACAAGTAGG - Intergenic
1153141838 18:1981418-1981440 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1157816304 18:50731552-50731574 CATATTTTCCATTTAAAAGTTGG - Exonic
1158028116 18:52928178-52928200 TTTAGCTTCCACTTATAAATAGG - Intronic
1158650331 18:59278684-59278706 CCTTCCTTTCACTTAAAAATAGG + Intronic
1159106795 18:64011838-64011860 CCCAGCTTCCACTTGTAAGGAGG - Intergenic
1159212367 18:65341934-65341956 CTTAGTTTCTACTTATAAGTGGG + Intergenic
1165732920 19:38157938-38157960 CCTAGTTTCCACTTCATACTCGG - Intronic
927359142 2:22211351-22211373 TCTAGATTCCACATATAAGTAGG + Intergenic
928710053 2:33994239-33994261 CCACGTTTCCACTTATAAGTGGG + Intergenic
928769673 2:34691787-34691809 TTTAGCTCCCACTTATAAGTGGG + Intergenic
929662037 2:43796387-43796409 ACTTTCTTCCATTTAAAAGTTGG - Intronic
929984472 2:46713719-46713741 CTAAGCTTTCACTTAAAACTAGG - Intronic
930252118 2:49046119-49046141 CCCAGCTGCTACTTAAAGGTTGG + Intronic
930391097 2:50762558-50762580 TTTAGCTTCCACTTATGAGTGGG + Intronic
930886315 2:56331150-56331172 CTTAGCTCCCACTTCTAAGTGGG - Intronic
931209149 2:60176254-60176276 CTTTTCTTCCACTAAAAAGTGGG - Intergenic
932862178 2:75305534-75305556 GCTAGCTTCCCCTAAAAAATGGG - Intergenic
935151835 2:100444185-100444207 TTTAGCTCCCACTTATAAGTGGG - Intergenic
935965158 2:108465570-108465592 CTTAGCTCCTACTTACAAGTGGG + Intronic
936273497 2:111070489-111070511 CCTAGCCTCCACTTTCAGGTAGG - Intronic
936720248 2:115242798-115242820 CTTAGCTCCCACTTATAACTGGG + Intronic
938987518 2:136592982-136593004 CTTAGATTCCACTTCAAATTTGG + Intergenic
939671275 2:145015568-145015590 CCTAGCTATCACCTCAAAGTGGG - Intergenic
940930123 2:159418442-159418464 CCTAGCTTTCAGTGAAATGTGGG - Intronic
942632370 2:177964606-177964628 TTTAGCTTCTACTTAAAAGTGGG + Intronic
945487334 2:210412308-210412330 CCTAGCCTCCACCTTTAAGTAGG + Intergenic
946008639 2:216546942-216546964 ACTTGCTGCCACTTAAGAGTAGG + Intronic
946056464 2:216906821-216906843 TTTAGCTTCCACTTATAAGTGGG - Intergenic
946737610 2:222770146-222770168 CTTAACTCCCACTTACAAGTGGG + Intergenic
946831686 2:223734285-223734307 CCCAGCCTCCTCTTTAAAGTAGG + Intergenic
946933209 2:224692322-224692344 CTTAGCTCCCACTTATAAGTGGG - Intergenic
1169835629 20:9874567-9874589 GCTAGCTTCCACTGATAAGACGG + Intergenic
1170763436 20:19271760-19271782 CTTAGCTCCCACTTATGAGTGGG - Intronic
1171275150 20:23850363-23850385 CCTAGCTGACACTAAAAAATAGG + Intergenic
1174752539 20:53125973-53125995 GCTAAATTTCACTTAAAAGTTGG + Intronic
1174975278 20:55326128-55326150 TCTAGTTTCCACTTATAAATTGG + Intergenic
1177741955 21:25165496-25165518 CCCAGCTTCCACCTGCAAGTAGG - Intergenic
1179097325 21:38327445-38327467 CCTTTCTTCCACTTGAGAGTGGG - Intergenic
1179356069 21:40661091-40661113 CATAGTTTCCACAGAAAAGTAGG + Intronic
1182347082 22:29673896-29673918 ACTAGCTTCCCTTTAAAGGTAGG - Intronic
950840269 3:15961674-15961696 CTTAGCTCCTACTTATAAGTAGG + Intergenic
955538008 3:59944744-59944766 ATTAGCTCCCACTTATAAGTGGG + Intronic
955736164 3:62040746-62040768 TCTATTTTCCACTTAAAAGCTGG - Intronic
957141463 3:76363910-76363932 CCAAGCCTCCACTTAAACCTTGG + Intronic
957505867 3:81119802-81119824 CTTAGCTCCCACTTATAAGCAGG - Intergenic
958559591 3:95728676-95728698 GCAAGTTTTCACTTAAAAGTGGG - Intergenic
959249294 3:103920841-103920863 CTTAGCTCCTACTTATAAGTGGG - Intergenic
959319401 3:104851711-104851733 TTTAGATTCCACCTAAAAGTGGG - Intergenic
960286890 3:115839638-115839660 CCTAACTTTCCCATAAAAGTGGG + Intronic
965171812 3:165275136-165275158 TTTAGCTTCCACTTGTAAGTGGG + Intergenic
965415856 3:168391344-168391366 TTTAGCTTCCACTTGTAAGTAGG - Intergenic
965798011 3:172461580-172461602 CCTACCTTCCTCTTCAAAATCGG + Intergenic
966451742 3:180071120-180071142 CCTCGTTTTCACTTTAAAGTAGG - Intergenic
967246820 3:187495802-187495824 CTTAACTCCCACTTATAAGTGGG - Intergenic
967605515 3:191440843-191440865 TGTAGCTTCCACTTATGAGTGGG - Intergenic
968249586 3:197195652-197195674 TTTAGCTCCCACTTACAAGTGGG - Intronic
970605694 4:17679949-17679971 CTTAGCCCCCACTTATAAGTGGG - Intronic
974220809 4:58968646-58968668 TTTAGCTCCCACTTATAAGTGGG - Intergenic
974668593 4:64998812-64998834 TTTAGCTTCCACTTATAAGTGGG - Intergenic
974712184 4:65612393-65612415 TTTAGCTACCACTTATAAGTGGG + Intronic
974731388 4:65871464-65871486 ACTACCTTGGACTTAAAAGTTGG + Intergenic
975891979 4:79040619-79040641 TTTAGCTCCCACTTATAAGTGGG - Intergenic
976693904 4:87898069-87898091 ACTAGCTTCCACTTACTAGCTGG + Intergenic
977566462 4:98585646-98585668 TTTAGCTTCCACTTGTAAGTGGG + Intronic
978147903 4:105398430-105398452 ACTGGTATCCACTTAAAAGTTGG + Intronic
978294337 4:107186185-107186207 CTTAGCTCCCACTTATAAGTGGG - Intronic
979285815 4:118923317-118923339 TTTAGCTCCCACTTATAAGTGGG - Intronic
979509687 4:121538118-121538140 CTTAGCTCTCACTTATAAGTGGG + Intergenic
979873696 4:125859756-125859778 CTTAGCTCCCACTTATAAGTGGG + Intergenic
980197955 4:129615789-129615811 CCAAGCATCCACTTAAAAGTTGG - Intergenic
980713256 4:136598053-136598075 TTTAGCTCCCACTTATAAGTGGG - Intergenic
981136475 4:141216184-141216206 ACAAGCTTCCACTTATATGTGGG - Intergenic
981568513 4:146126733-146126755 CCTGGCTTCCAGCTAAAAGTTGG + Intergenic
982138424 4:152294914-152294936 CCTAGTTTCCAGTTTAAAGATGG - Intergenic
982152042 4:152470396-152470418 TCTAGGTGCCACTTAAAAGATGG - Intronic
983136956 4:164096339-164096361 TTTAGCTTCCATTTATAAGTGGG - Intronic
983185513 4:164695934-164695956 TTTAGCTTCCACTTATAAGTGGG - Intergenic
985436649 4:189936878-189936900 TTTAGCTCCCACTTATAAGTGGG + Intergenic
985546580 5:512961-512983 CTTATCTTCCAGTGAAAAGTGGG - Intronic
986181162 5:5394073-5394095 CCTAGTTTCAGCTTAAAATTTGG + Intergenic
986778862 5:11045902-11045924 CCTGTCTTCCACTGATAAGTTGG + Intronic
986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG + Intergenic
987706967 5:21470437-21470459 CCTAGTTTCAGCTTAAAATTTGG - Intergenic
989558869 5:42828294-42828316 TTTAGCTCCCACTTATAAGTGGG + Intronic
989565391 5:42896378-42896400 TCCAGCTCCCACTTATAAGTGGG - Intergenic
991281487 5:64919574-64919596 TCTATCTTCCACTTATAAGTGGG + Intronic
991571421 5:68057845-68057867 CCTAGACTCCAGTTAGAAGTCGG - Intergenic
991657263 5:68916397-68916419 TTTAGCTCCCACTTATAAGTGGG + Intergenic
993138991 5:84006495-84006517 TTTAGCTTGCACTTACAAGTGGG - Intronic
995261332 5:110107617-110107639 CCTAGTTACTACTTAAAAGAGGG - Intergenic
996310173 5:122095609-122095631 CCCAGCTTCCACTGAAAATGTGG + Intergenic
997780194 5:136649802-136649824 CTTAGCTTTCACTTAAGAATGGG + Intergenic
998275357 5:140747340-140747362 TTTAGCTCCCACTTAGAAGTAGG + Intergenic
998880874 5:146643519-146643541 CTTAGCTTCCACTTATGAGTGGG - Intronic
999109305 5:149104158-149104180 CCTCGCTTCTCCCTAAAAGTGGG + Intergenic
999605449 5:153309193-153309215 CCTAGCCTCCACTTATAGGAAGG - Intergenic
1000625782 5:163536538-163536560 CCATGTTTCCACTTATAAGTAGG - Intergenic
1002123671 5:177024882-177024904 CCTAGATTTCACATAAATGTGGG - Intronic
1003734570 6:8864247-8864269 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1004641012 6:17515380-17515402 TTTAGCTTCCACTTGTAAGTGGG - Intronic
1008257580 6:49322980-49323002 CAGACCTTCCACTTCAAAGTGGG + Intergenic
1009021258 6:57950062-57950084 CCTAGTTTCAGCTTAAAATTTGG + Intergenic
1009279512 6:61729251-61729273 TTTAGCTCCCACTTATAAGTGGG - Intronic
1009779462 6:68251077-68251099 CTTAGCTCCAACTTATAAGTGGG + Intergenic
1009895346 6:69742665-69742687 CTTTGCTTACACTTAAAATTAGG - Intronic
1010315830 6:74449088-74449110 CTTAGCTCCCGCTTATAAGTGGG + Intergenic
1011772014 6:90683734-90683756 TATGGCTCCCACTTAAAAGTAGG - Intergenic
1013149752 6:107432992-107433014 CTTAGCTCCCACATATAAGTGGG + Intronic
1013259587 6:108428167-108428189 CTTAGCTCCCACTTGTAAGTGGG + Intronic
1013954204 6:115821512-115821534 CCTAGCTCCCACTTAGAAATGGG - Intergenic
1014194065 6:118532271-118532293 CCACGTTTTCACTTAAAAGTGGG + Intronic
1014476902 6:121884722-121884744 CCTTTCTTCCTCTGAAAAGTTGG + Intergenic
1014626817 6:123736611-123736633 CTTAGCTTCCACTTGTAAATGGG - Intergenic
1015895503 6:138012796-138012818 TCTGGCCTCCACTTAAATGTTGG - Intergenic
1015912657 6:138184099-138184121 CATAGCTTCTATTTAAAATTTGG + Intronic
1017368586 6:153676134-153676156 TTTAGCTTCCACTTATAAGTGGG + Intergenic
1017412801 6:154186932-154186954 TCTGGGTTCCACTCAAAAGTGGG - Intronic
1018183681 6:161246213-161246235 CCTGGATTCTGCTTAAAAGTTGG - Intronic
1020763706 7:12296074-12296096 CCTAGAATCCACTGAACAGTGGG + Intergenic
1022991411 7:35711952-35711974 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1024365804 7:48519031-48519053 CTCAGCTCCCACTTATAAGTGGG + Intronic
1024733767 7:52280823-52280845 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1024779063 7:52824928-52824950 AGTAGCTTCCACTAGAAAGTGGG + Intergenic
1024847381 7:53662785-53662807 CTTAGCTTCCACTTATATGTGGG + Intergenic
1025003310 7:55336384-55336406 CTTAGCTTCCACTTGGAAGTGGG + Intergenic
1025071982 7:55907677-55907699 TTTAGCTCCCACTTACAAGTGGG + Intronic
1026379152 7:69781941-69781963 CCTTGCCTCCACTTAAGAGAAGG - Intronic
1026401542 7:70019186-70019208 TTTAGTTTCCACTTAAAAGTGGG - Intronic
1027333950 7:77128549-77128571 TCTGGCTTTCACTTAAAAGCAGG + Intronic
1027604831 7:80287708-80287730 CCTTCCTTCCACTTAAAGGGAGG + Intergenic
1029781843 7:102742743-102742765 TCTGGCTTTCACTTAAAAGCAGG - Intergenic
1030298367 7:107951389-107951411 TCTAGCTGCCACTTAGAAGTAGG + Intronic
1032415246 7:131730488-131730510 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1036697000 8:10981693-10981715 CCCAGCTTCCCCTGAAAACTTGG + Intronic
1036942675 8:13066801-13066823 CTTAGCTCCCACTTATGAGTGGG - Intergenic
1037001294 8:13722599-13722621 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1037374688 8:18214905-18214927 TTTAGCTCCCACTTATAAGTAGG + Intronic
1037959965 8:23089960-23089982 CCAGGTTTCCACTTAAAAGCTGG + Intronic
1038323686 8:26553445-26553467 CTTAGCTCCCACTTATAAGTGGG + Intronic
1038423320 8:27448078-27448100 TCCAGCTTCTATTTAAAAGTTGG + Intronic
1038709154 8:29925062-29925084 CTTAGCTCCCTCTTATAAGTGGG + Intergenic
1039014946 8:33136876-33136898 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1039408186 8:37330427-37330449 CCTATATTCCACAAAAAAGTTGG + Intergenic
1039442639 8:37605635-37605657 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1040943933 8:52861981-52862003 TTTAGCTCCCACTTATAAGTAGG + Intergenic
1041471122 8:58210054-58210076 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1042006649 8:64187584-64187606 TTTAGCTCCCACTTACAAGTGGG - Intergenic
1043249261 8:78049548-78049570 CCATGCTTTCACTTATAAGTGGG - Intergenic
1043691632 8:83160534-83160556 CTTAGCTCCCACTTATGAGTGGG + Intergenic
1044516659 8:93146728-93146750 TTTAGCTCCCACTTATAAGTGGG + Intronic
1046333173 8:112748558-112748580 TTTAGCTCCCACTTATAAGTGGG + Intronic
1046975465 8:120271147-120271169 TTTAGCTCCCACTTATAAGTGGG - Intronic
1047115723 8:121839796-121839818 CTTAGGTTCCACTTAACAGCAGG - Intergenic
1047709347 8:127535673-127535695 CCTAGTTTCCTCTTTAAAGCAGG + Intergenic
1048668028 8:136686213-136686235 CCTACCTTCCACTTTCAGGTAGG - Intergenic
1050762817 9:9094443-9094465 CTTAGCTCCCACTTATAAGTGGG - Intronic
1052107428 9:24536554-24536576 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1052793085 9:32895714-32895736 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1054975796 9:71143406-71143428 TTTAGCTCCCACTTACAAGTGGG + Intronic
1055216976 9:73876215-73876237 GCTAGCTGCCACTGGAAAGTGGG + Intergenic
1055225775 9:73992953-73992975 TTTAGCTTCCACTTATGAGTCGG - Intergenic
1055866895 9:80825468-80825490 CTTAGCTTCCAGTTATGAGTGGG - Intergenic
1055960320 9:81814419-81814441 CCTATGTTCCCTTTAAAAGTAGG + Intergenic
1056242877 9:84667508-84667530 ACTATCTCCCACTTAAAATTAGG - Intergenic
1056671313 9:88629763-88629785 CTTAGCTCCCACTTATAAGCAGG + Intergenic
1058610925 9:106774556-106774578 TGGAGCTTCCACTTATAAGTTGG - Intergenic
1059036572 9:110760484-110760506 TTTAGCTCCCACTTATAAGTGGG - Intronic
1185908428 X:3959656-3959678 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1186232633 X:7472515-7472537 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1186296966 X:8160100-8160122 CTTAGCTCCCACTTACGAGTGGG + Intergenic
1186938685 X:14479607-14479629 CCACGTTTTCACTTAAAAGTGGG - Intergenic
1187769145 X:22676327-22676349 CCTACCTTCAACTTAATAATGGG + Intergenic
1187920161 X:24194033-24194055 CCTAGCTACCTCTTATAAGTGGG + Intronic
1187994067 X:24906450-24906472 CTTAGCTCCCCCTTATAAGTGGG - Intronic
1188273564 X:28173720-28173742 CTTAGCTGCCACTTATAAGTGGG + Intergenic
1188732966 X:33674623-33674645 CTTAACTCCCACTTACAAGTGGG + Intergenic
1189709286 X:43793103-43793125 CTTAGCTCTCACTTATAAGTGGG - Intronic
1191147449 X:57182965-57182987 TTTAGCTTCCACTTACAAATGGG - Intergenic
1192512473 X:71731243-71731265 TTTAGCTCCCACTTATAAGTGGG - Intergenic
1192514224 X:71750266-71750288 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1193188100 X:78537566-78537588 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1193979531 X:88164814-88164836 ACTAGCTCCCACTTACAAGCAGG + Intergenic
1194194628 X:90877634-90877656 CCCACCTTCCACTTTCAAGTGGG + Intergenic
1195784571 X:108505156-108505178 CTTAACTCCCACTTACAAGTGGG - Intronic
1196052318 X:111318718-111318740 TTTAGCTCCCACTTATAAGTGGG - Intronic
1196598912 X:117578479-117578501 CTTAGCTTCTACTTATAAGTGGG + Intergenic
1197171526 X:123440013-123440035 TTTAGCTGCCACTTATAAGTGGG + Intronic
1197496965 X:127196145-127196167 CTTAGCTCCAACTTATAAGTGGG - Intergenic
1199109110 X:143909389-143909411 TTTAGCTCCCACTTATAAGTGGG + Intergenic
1199558269 X:149133189-149133211 CCTAGCCTCCATATAAGAGTAGG + Intergenic
1200541245 Y:4460036-4460058 CCCACCTTCCACTTTCAAGTGGG + Intergenic