ID: 920898932

View in Genome Browser
Species Human (GRCh38)
Location 1:210087241-210087263
Sequence TAGAGCCTAAGCAGCATGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920898932_920898940 29 Left 920898932 1:210087241-210087263 CCGCCCATGCTGCTTAGGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 920898940 1:210087293-210087315 ATGCACACCTTACCCTGCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
920898932_920898935 -10 Left 920898932 1:210087241-210087263 CCGCCCATGCTGCTTAGGCTCTA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 920898935 1:210087254-210087276 TTAGGCTCTAGTATCCCGATAGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920898932 Original CRISPR TAGAGCCTAAGCAGCATGGG CGG (reversed) Intronic
900298013 1:1961983-1962005 TGGAGCCTGGGCAGCAAGGGGGG + Intronic
901757831 1:11452083-11452105 TAGAGCAGAAGCAGGCTGGGAGG + Intergenic
903648974 1:24911672-24911694 CAGAGCCTGAGCAGCAAGGCAGG + Intronic
907011058 1:50963582-50963604 TATAAACTAAGCAGCATGGAAGG - Intronic
918939928 1:190980311-190980333 TAAAGCTTACGCAGCATGGAAGG + Intergenic
919131890 1:193461569-193461591 TAGCACCTAAGCATCAAGGGTGG + Intergenic
920898932 1:210087241-210087263 TAGAGCCTAAGCAGCATGGGCGG - Intronic
921106928 1:211990773-211990795 TAGAGGCTAAGTAAGATGGGGGG + Intronic
921330716 1:214033011-214033033 TAGAACATCAGCAGCAGGGGAGG - Intronic
923625041 1:235606835-235606857 TTGGCCCAAAGCAGCATGGGGGG + Intronic
924814811 1:247432256-247432278 TAGAGCCTCAGAAGGGTGGGAGG - Intronic
1063208237 10:3855031-3855053 TAGAGCCCAACCAGCCTTGGAGG - Intergenic
1073083356 10:100873563-100873585 AAGAGCCTATGCAGCAGGGCTGG + Intergenic
1076008322 10:126966021-126966043 TAGAGCCTAAGAAGGGTAGGGGG - Intronic
1081320496 11:41686499-41686521 TAGAATCTAAGCAGTTTGGGAGG + Intergenic
1083468335 11:62864408-62864430 TATAGCCTCAGCTGCTTGGGAGG - Intronic
1084874649 11:72121953-72121975 TAGAGACTAAGTAGAATGGTGGG - Intronic
1087061221 11:93979732-93979754 TAGAACATAGGCAGCATGGTAGG + Intergenic
1090680865 11:129056366-129056388 TATAGTCTAAGCTGCTTGGGAGG - Intronic
1090853068 11:130587474-130587496 TTGAGCCTGAGCAGGATGGGAGG - Intergenic
1094409050 12:30149896-30149918 GAGAGCCTAGGCAGCAGGGATGG + Intergenic
1097335646 12:58379998-58380020 TGGAGACTCTGCAGCATGGGTGG + Intergenic
1099771234 12:87060219-87060241 TAAAGCCAAAGCAGCATGCATGG + Intergenic
1101484091 12:105133507-105133529 TAGAATGTAAGCATCATGGGAGG + Intronic
1101711066 12:107267411-107267433 AGGAGCCAAAGCAGCTTGGGTGG + Intergenic
1102100011 12:110270894-110270916 TAAAGTCTAAGCACCTTGGGGGG + Intergenic
1104683749 12:130770974-130770996 GAGACCCTAACCAGCATAGGAGG - Intergenic
1105774157 13:23641004-23641026 TAGTGCCCAAGCAGCTAGGGAGG + Intronic
1106396686 13:29387373-29387395 AAGAGCCTAAGCAGGAAGGATGG + Intronic
1106800424 13:33250801-33250823 TAGAGACTAAGGAACATGGGAGG - Intronic
1111901094 13:94200613-94200635 GAGAGGCTAAGCAACATGGCAGG + Intronic
1116422465 14:44748794-44748816 TAGAGACTAAGAAGGGTGGGGGG + Intergenic
1118318592 14:64740511-64740533 TAGACCCTAATCCACATGGGAGG + Intronic
1118348548 14:64957467-64957489 TAGAGCATCAGCAGCATCAGAGG + Intronic
1118973365 14:70655918-70655940 AAGAGTCCAAGCAGCATGGCGGG - Intronic
1121614617 14:95304852-95304874 GGGAGCCCAAGCAGCCTGGGAGG + Intronic
1123162867 14:106296656-106296678 TGGAGACTTAGCAGAATGGGAGG - Intergenic
1124231958 15:27953467-27953489 TAGGGCCAAAGGAGCATGGCAGG + Intronic
1125743923 15:41986385-41986407 TAGGGCCTCAGCAGCAGAGGAGG + Intronic
1127015877 15:54687252-54687274 TTAAGCCTAAGAAGCATGGGTGG - Intergenic
1127261385 15:57329184-57329206 TAGAGCCAGAGTAGCATAGGGGG + Intergenic
1131059771 15:89397542-89397564 TAGGGCCTCAGTAGCCTGGGAGG + Intergenic
1136772441 16:32853104-32853126 TGGAGACTTAGCAGAATGGGAGG + Intergenic
1136898174 16:34008413-34008435 TGGAGACTTAGCAGAATGGGAGG - Intergenic
1137905694 16:52319777-52319799 CAGAGCCTAGGCCTCATGGGAGG + Intergenic
1140930750 16:79625479-79625501 TAGCTCCAAAGCACCATGGGAGG + Intergenic
1203074863 16_KI270728v1_random:1115202-1115224 TGGAGACTTAGCAGAATGGGAGG + Intergenic
1142620296 17:1161361-1161383 TAGAGTCTAAGCTACTTGGGAGG - Intronic
1143882494 17:10040324-10040346 TAGAGTTTAAGAGGCATGGGAGG + Intronic
1148367697 17:47069088-47069110 TAGAGACTGAGCAGCATGATTGG + Intergenic
1152210531 17:79000811-79000833 GAGAGCCGGAGCGGCATGGGAGG - Intronic
1153332997 18:3893057-3893079 TGGAGACTCAGAAGCATGGGAGG - Intronic
1154239205 18:12636979-12637001 GAGAGCCTACTCTGCATGGGGGG + Intronic
1158879612 18:61764713-61764735 TGGAGCATAAGCAGAATGTGGGG + Intergenic
1160133819 18:76254395-76254417 TACAGCCTAAGGACCTTGGGTGG - Intergenic
1160722697 19:604379-604401 TAGAGCCAAGACAGCAGGGGTGG + Intronic
1161242981 19:3233163-3233185 TAGAGCCCTAGCTGCTTGGGAGG + Intronic
1163003863 19:14385431-14385453 TAGAGACAAAGAAGCAGGGGTGG - Intronic
1165170519 19:33888738-33888760 CTGAGCCTACACAGCATGGGGGG + Intergenic
1167358753 19:49018995-49019017 TAGAGCCTGAGCAAGATTGGGGG + Intergenic
1167366445 19:49057243-49057265 TAGAGCCTGAGCAAGATTGGGGG + Exonic
1167510498 19:49893256-49893278 TAGAGCCTGGGCAGCTTGAGAGG + Intronic
926120552 2:10239252-10239274 TAGAGCCCACCCATCATGGGGGG + Intergenic
927133200 2:20078250-20078272 TAGGGCCAACACAGCATGGGGGG - Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
933660758 2:84925598-84925620 TAAAGCTTAAGCATCATGAGAGG + Intergenic
945199347 2:207265590-207265612 TAGAGCCTGAGCAACATGGCGGG - Intergenic
945284927 2:208072654-208072676 TACAGCCTATGCAGAAAGGGAGG - Intergenic
947010719 2:225563309-225563331 TAGAGGTTAAGTAGCAAGGGAGG + Intronic
1168798365 20:627524-627546 TAGAACCCAAGATGCATGGGCGG + Intergenic
1174550280 20:51357065-51357087 CAGAGCCTGAGCAGCCAGGGAGG + Intergenic
1179076301 21:38125053-38125075 TAGAGGCAAAGCAGAATGGTGGG - Intronic
1181347921 22:22233836-22233858 TAGACTCTAAGCTTCATGGGAGG + Intergenic
1184994966 22:48198991-48199013 TAGAGGCTGAGCTGCATGAGAGG + Intergenic
1185096327 22:48808024-48808046 TAGGGTCTCAGCAGCATGGTAGG + Intronic
1185280028 22:49966068-49966090 CAGAGCCAAAGCAGCAGAGGTGG - Intergenic
949810417 3:8001150-8001172 AAGACCCTGGGCAGCATGGGTGG - Intergenic
952976940 3:38704710-38704732 TAGAGCCTGAGCATCATCAGAGG + Intronic
955932573 3:64072442-64072464 TAGAGCCCAAGAAGAATGGGTGG - Intergenic
958040992 3:88226359-88226381 TAGAGGCTGAGAAGGATGGGTGG - Intergenic
959001635 3:100970809-100970831 AAGTGCCCAAGAAGCATGGGAGG + Intronic
960450246 3:117798271-117798293 TAAAGCCTAAGCAGCAAAGGTGG + Intergenic
961128718 3:124445791-124445813 CAGAGTCTAATGAGCATGGGTGG - Intronic
961812782 3:129531372-129531394 TTGGGCCTCAGCAGCAGGGGAGG + Intronic
962809481 3:138948649-138948671 CAGAGTCTAAACAGCCTGGGAGG - Intronic
963600429 3:147373568-147373590 AGGAGCCTTAGCAGCAAGGGTGG - Intergenic
963906579 3:150778608-150778630 TTGAGCCCAGGCAGCATGGTGGG - Intergenic
967784166 3:193471905-193471927 TGGATCCTAAGCAGGATGGAAGG + Intronic
980177286 4:129362306-129362328 TAGAGCTTATACAGCATTGGAGG - Intergenic
981009969 4:139915673-139915695 TGGTGGCTAAGCAGCATTGGCGG + Intronic
981366260 4:143907207-143907229 AAGACCCTAAGCAGAATTGGAGG - Intergenic
981376368 4:144020984-144021006 AAGAGCCTAAGCAGAATTGGAGG - Intergenic
983097618 4:163582990-163583012 TAAAGCCTATGCATCATGGAGGG + Intronic
996594812 5:125188204-125188226 TAGAGCTTCACCATCATGGGAGG - Intergenic
998848083 5:146330331-146330353 TAGAGGCTAAGCCCCATGAGTGG + Intronic
1001544808 5:172564338-172564360 TGCACGCTAAGCAGCATGGGTGG + Intergenic
1004005413 6:11633303-11633325 TTGAGCCTGAGCCGCCTGGGAGG - Intergenic
1006793048 6:36716125-36716147 TAGAGCCTGAGATGGATGGGAGG - Intronic
1008302187 6:49854751-49854773 TAATGCCTAAGCAGCAGGGCAGG - Intronic
1011739359 6:90344341-90344363 TAGAGTCTCACCAGCATGTGAGG - Intergenic
1012549273 6:100452953-100452975 TTGAACCTAAGCAGCATTTGGGG - Intronic
1014282125 6:119453280-119453302 AAGGGCTTGAGCAGCATGGGTGG + Intergenic
1015285458 6:131481600-131481622 TAGAGGCTAAGAAGGATAGGGGG - Intergenic
1021328896 7:19310085-19310107 CAGAGCATTAGCAGCATTGGAGG - Intergenic
1021565524 7:22012903-22012925 TATATCATAAGCAGCATGGGGGG + Intergenic
1021635858 7:22692243-22692265 TATAGTCTCAGCTGCATGGGAGG - Intergenic
1027229620 7:76264636-76264658 TAGGGCCTAAGCCCCATGGCTGG - Intronic
1030423791 7:109345341-109345363 TAGGGTCTCAGCTGCATGGGTGG + Intergenic
1033239539 7:139665606-139665628 TTGTGACTAAGCACCATGGGTGG - Intronic
1033931960 7:146534336-146534358 TAAAGCCTCAGGAGTATGGGAGG - Intronic
1034479514 7:151308647-151308669 CAGAGCCAAAGCAGGATGGAGGG - Intergenic
1035148964 7:156850443-156850465 AAGAGTCTAAGCAGGGTGGGAGG - Intronic
1040028230 8:42801123-42801145 TAGAGCCTAATCATCTGGGGTGG + Intergenic
1040813773 8:51484778-51484800 TATAGCCAAGGCAGCATGGAGGG - Intronic
1047146665 8:122208175-122208197 TGGAGACTCAGCAGGATGGGAGG - Intergenic
1048036563 8:130682895-130682917 TAGAGCACAGGCAGCATGTGAGG - Intergenic
1048222623 8:132555835-132555857 TAGATCCTAAGCAGGAAGTGAGG - Intergenic
1049485595 8:142858268-142858290 TGGAGCCTGAGCAGCATTGCTGG + Intronic
1051278909 9:15422437-15422459 TAGAGCCTAAGAAACAAGGAGGG - Intergenic
1058168183 9:101645155-101645177 TAGAGGTTAGGAAGCATGGGGGG - Intronic
1187938646 X:24360920-24360942 TCGAGCCAAATCAGCATGGGTGG + Intergenic
1196945695 X:120823228-120823250 TACACCCTAAGCAGCCTGGCTGG + Intergenic
1199208920 X:145183154-145183176 GAGAGCCTAAGCACAAAGGGTGG + Intergenic
1200127856 X:153825238-153825260 TAAAGCCTGAGTAGGATGGGCGG + Intronic