ID: 920912577

View in Genome Browser
Species Human (GRCh38)
Location 1:210232640-210232662
Sequence CGGCCTGAGCAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 622}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920912572_920912577 -5 Left 920912572 1:210232622-210232644 CCTGAGGAGCGGCGGCGGCGGCC 0: 1
1: 2
2: 8
3: 83
4: 490
Right 920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 84
4: 622
920912568_920912577 5 Left 920912568 1:210232612-210232634 CCGTGTGCAGCCTGAGGAGCGGC 0: 1
1: 1
2: 2
3: 17
4: 220
Right 920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 84
4: 622
920912566_920912577 6 Left 920912566 1:210232611-210232633 CCCGTGTGCAGCCTGAGGAGCGG 0: 1
1: 0
2: 2
3: 16
4: 172
Right 920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 84
4: 622
920912565_920912577 7 Left 920912565 1:210232610-210232632 CCCCGTGTGCAGCCTGAGGAGCG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 84
4: 622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920912577 Original CRISPR CGGCCTGAGCAGAGGGAGGG AGG Intergenic
900156772 1:1206294-1206316 CGGTCTGAGCACGGGAAGGGGGG + Intronic
900291851 1:1927067-1927089 CGGCCTGGGCCGATGGTGGGTGG - Intronic
900512667 1:3067993-3068015 CGGGCTGAGCGCAGGCAGGGTGG - Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900575801 1:3381958-3381980 CGGCCAGTGGTGAGGGAGGGGGG + Intronic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
901226066 1:7613703-7613725 CAGCCTGAGGAGAGCGATGGCGG + Intronic
901228132 1:7626358-7626380 CCTCCAGAGCAGAGGAAGGGTGG + Intronic
901232129 1:7647162-7647184 CCTCCGGAACAGAGGGAGGGAGG - Intronic
901702457 1:11053002-11053024 CGGCCCGAGAGAAGGGAGGGTGG - Intergenic
901877455 1:12175096-12175118 CGGGCTGTGGACAGGGAGGGGGG + Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902481030 1:16711969-16711991 TGGTCTGTGCAGTGGGAGGGAGG - Intergenic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903769722 1:25756345-25756367 TGGCCTGGGCAGAGGCAGGCAGG - Intronic
903968380 1:27103374-27103396 GGGCCTGGGGTGAGGGAGGGAGG - Intronic
904236840 1:29122090-29122112 CGGGCGGAGAGGAGGGAGGGGGG + Intronic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904410985 1:30324832-30324854 AGGCCTGGGCAGACGCAGGGTGG + Intergenic
904472604 1:30745432-30745454 GGGGCTGAGGGGAGGGAGGGGGG - Intronic
904563426 1:31413483-31413505 AGGACTGAGCAGGGGGACGGGGG - Intronic
904577801 1:31516593-31516615 AGGCCTGAGGAGAAGGAGAGAGG - Intergenic
905316710 1:37086563-37086585 GGGCCTGAACAGACGGAGGCAGG - Intergenic
905370495 1:37480213-37480235 AGGCCTGAGCAGGAGGAGGGAGG - Intronic
905495723 1:38384276-38384298 GGCCCTGAGCATAGTGAGGGAGG + Intergenic
905935543 1:41821250-41821272 CTGCCTGAGAAGACGGAGTGAGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906697973 1:47837511-47837533 TGGCGGGAGCAGAGGCAGGGAGG - Intronic
906942657 1:50269118-50269140 ATGCCTCAGCACAGGGAGGGAGG + Intergenic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907797533 1:57732408-57732430 CAGCCTGAGCAGGCGGAGAGAGG + Intronic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
911044291 1:93615900-93615922 AGGCCTGAGAAAAGGGAGGGGGG + Intronic
911618334 1:100038543-100038565 CGGCCAGAGCAGAGGGCGGCAGG - Intronic
912457652 1:109808546-109808568 AGGCCAGAGGAGAGGGAGGTAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912853451 1:113146869-113146891 AGCCATGGGCAGAGGGAGGGAGG - Intergenic
912878791 1:113389511-113389533 CTGCCTGAGGTGAGGGAGTGGGG - Intergenic
913044322 1:115060962-115060984 CGGCCTGGGCATGGGGAAGGGGG + Intronic
913127390 1:115805429-115805451 TGTCTTGAGAAGAGGGAGGGTGG + Intergenic
914334392 1:146701365-146701387 CGGAGGGAGCAGAGGGAGAGTGG - Intergenic
914777253 1:150749043-150749065 AGGCCTGAGGAGAGAGATGGGGG - Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
917563775 1:176188778-176188800 TGGCCTGAGGAGAGGAAGAGAGG - Intronic
917797286 1:178541641-178541663 TGGCCAGAGTAAAGGGAGGGAGG - Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920109242 1:203575474-203575496 TGGCATGGGCAGAGTGAGGGTGG - Intergenic
920173303 1:204084699-204084721 GGGCCTGAGAGGAGGGAGGAAGG - Intronic
920693317 1:208163371-208163393 CAGCCTGGGCTGGGGGAGGGAGG + Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921216014 1:212937289-212937311 AGGCCTGAGAAGAGGGGGTGGGG + Intergenic
921828852 1:219704319-219704341 AGGCCTGTGGAGAGGGAGAGAGG - Intronic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922175030 1:223190058-223190080 CGTCCTGGGCAGAGAGAGGTGGG - Intergenic
922547233 1:226466999-226467021 CTGCCTGAACTGAGGGTGGGAGG + Intergenic
922581713 1:226703348-226703370 GGGCCTGAGCTGAGGGCGGAGGG - Intronic
923211132 1:231805470-231805492 CGGCCAGAGCAGGAGGAGGGGGG + Intronic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
924923654 1:248657681-248657703 AGGGCTGAGCGAAGGGAGGGAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063487177 10:6430754-6430776 GGCCCTGAGCGGAGGGAGAGTGG + Intronic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1066242581 10:33552487-33552509 TGGCCTGCGCACTGGGAGGGTGG - Intergenic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1066686952 10:37990725-37990747 GGGCCTGAACAGTGGGAGAGAGG - Intergenic
1066961527 10:42231301-42231323 AGGGCTGAGCAGAGTCAGGGCGG + Intergenic
1067154092 10:43760473-43760495 CAGCCTGAGCTCAGGGAGTGGGG - Intergenic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1069403929 10:68077840-68077862 GGACCTGAGAAGATGGAGGGAGG + Intergenic
1069642102 10:69962736-69962758 GGGCCTGAGAGGAGGGAGGGAGG - Intronic
1070324415 10:75378521-75378543 CTGCCTGGGCTGAGGGAGGGAGG - Intergenic
1070567361 10:77614039-77614061 AGGCCTGGGCAGTGGTAGGGAGG - Intronic
1070772705 10:79091686-79091708 CGGCATGACCAAAGGAAGGGAGG + Intronic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1072613473 10:97034615-97034637 GGCCCTGGGCAGAGTGAGGGAGG - Intronic
1073125341 10:101145837-101145859 CGGCCTGGGCACAGTGAGGCTGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074771749 10:116739487-116739509 GGGCTTGAGGAGAGGGATGGTGG - Intronic
1075068809 10:119307428-119307450 GGGCCTGATTAGAGGGAGAGTGG + Intronic
1075911708 10:126130736-126130758 TGGCCTGGGAAGAGGGATGGAGG + Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076677741 10:132156203-132156225 GAGACTGAGCCGAGGGAGGGAGG - Intronic
1076721393 10:132394965-132394987 CGGGCAGGGCAGAGGGAAGGTGG + Intergenic
1077227601 11:1445173-1445195 CGGGCTGGGCACAGGGAGAGTGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077541000 11:3146464-3146486 TGGCCTGAGGAGAGGCTGGGTGG + Intronic
1078357581 11:10643745-10643767 CGGTCGGAGCTTAGGGAGGGAGG - Intronic
1078507354 11:11962198-11962220 GGCCATGGGCAGAGGGAGGGAGG - Intergenic
1078869556 11:15330715-15330737 AGGCCTGAGAAGCAGGAGGGAGG - Intergenic
1079035037 11:17013893-17013915 CGGCGGGAGCAGAGGAAGGGCGG + Intronic
1079131091 11:17747362-17747384 CTGCCAGGGGAGAGGGAGGGAGG + Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080411724 11:32031260-32031282 GGGCATGAGCGGAGGGAGCGTGG - Intronic
1080822164 11:35817845-35817867 TGGCCAGAGCAGAAGGAAGGTGG - Exonic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081390500 11:42523401-42523423 CGGCCTGATGAGAGGAATGGTGG - Intergenic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082986376 11:59173487-59173509 AGGCCGGAGCAGATGGAGAGAGG + Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083609930 11:63999832-63999854 CGGCCTGGGCAGAAGGGGGCAGG + Intronic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1084001205 11:66296201-66296223 GGCCCTGAGCAGCGGGAGAGAGG - Exonic
1084115711 11:67041857-67041879 GGGCCAGAGCAGAGGGGGGAAGG + Intronic
1084284366 11:68121677-68121699 CGGACTGGGCCGAGCGAGGGAGG + Intergenic
1084402872 11:68955458-68955480 CGCCCTGGCCTGAGGGAGGGCGG + Intergenic
1084453978 11:69256820-69256842 CCACCAGTGCAGAGGGAGGGAGG + Intergenic
1084475660 11:69387199-69387221 CTGACCGAGCAGAGGGAGGAAGG - Intergenic
1084490664 11:69476566-69476588 CGGGCTGGGGAGAGGGAAGGGGG - Intergenic
1084653539 11:70502498-70502520 GGGCCTGGGCAGGGGGAGGGAGG + Intronic
1084724769 11:70934370-70934392 CGGCCTGAGAAGCAGGAGGGAGG - Intronic
1084761482 11:71274802-71274824 AGGCCTGAGGAGAGGGAGAGAGG - Intergenic
1085282884 11:75342326-75342348 GGCCCAGAGCAGAGGGAAGGGGG - Intronic
1085327223 11:75615912-75615934 AGGCCCCAGAAGAGGGAGGGAGG + Intronic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1085976541 11:81661667-81661689 AGCTCTGAGAAGAGGGAGGGAGG - Intergenic
1088279532 11:108121985-108122007 CGGCCTGAGCGGTGGGATCGGGG + Intronic
1088389475 11:109298358-109298380 AGGCCTGAGCAGAGAGAGAGAGG + Intergenic
1088695470 11:112362452-112362474 AGGCCTGAGCAGAGTGTGCGAGG + Intergenic
1089349952 11:117816572-117816594 CGAGCAGAGCGGAGGGAGGGTGG + Intronic
1089693338 11:120200048-120200070 GAGCCAGGGCAGAGGGAGGGAGG + Intergenic
1090218218 11:124990194-124990216 AGGCCTAAGGAGAGGTAGGGGGG + Intronic
1090238546 11:125166140-125166162 CGGCCAGAGCAGAGGGCTGGAGG + Intronic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090645629 11:128764842-128764864 CTCCCTGAGCAGTGGGAGGAGGG + Intronic
1090884131 11:130861467-130861489 CGGCCGGAGCAGAGGCCGCGCGG - Intergenic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1096445227 12:51683989-51684011 TGGGCAGGGCAGAGGGAGGGAGG + Intronic
1096482430 12:51951626-51951648 CGGGCGGAGGAGAGGGAGGCGGG + Intergenic
1096693026 12:53332854-53332876 CGGGCTGGGCAGAGGGAGAGGGG - Intronic
1096786954 12:54022288-54022310 GGGGCTGAGGAGAGGGAGTGTGG - Intronic
1096833100 12:54329957-54329979 TGCCCAGAGCAGGGGGAGGGGGG - Intronic
1097281293 12:57846602-57846624 CGGCCTGTACAAAGGGCGGGCGG + Exonic
1097282196 12:57852009-57852031 CTGCCTGTGCAAAGGTAGGGAGG - Intergenic
1097471390 12:59997459-59997481 AGGCCTGAGGAGAGGGAGTATGG - Intergenic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1099016369 12:77348382-77348404 TGGCTGGAGCAGAGGGAAGGGGG + Intergenic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1100913165 12:99388486-99388508 AGGCCAGAGCAGATGGAGAGAGG + Intronic
1101410484 12:104463862-104463884 TGCCCAGAGCAGAGGGACGGAGG + Intronic
1101685034 12:107010881-107010903 AGGCCTGAGGAGAGGGAGAGAGG - Intronic
1102486421 12:113260757-113260779 TGCCCTGAGAAGAGGGAGGGTGG - Intronic
1102890834 12:116557568-116557590 TGGCCTGAGCAGAAGGTGGGAGG - Intergenic
1102992160 12:117322896-117322918 AGGCCTTAGAGGAGGGAGGGAGG - Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103243471 12:119434772-119434794 TGGCCAGAGCAGAGTGAGAGAGG + Intronic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1103974907 12:124696148-124696170 AGGCCTGAGAAGCTGGAGGGAGG - Intergenic
1104676460 12:130715096-130715118 AGGCCTGAGAGGAGGGAGAGCGG - Intronic
1104759546 12:131288757-131288779 CGCCCTGGGGAGAGGGAGGAGGG + Intergenic
1104803288 12:131569351-131569373 TGTCCTGAGGAGAGGGAGGGAGG - Intergenic
1104821167 12:131678455-131678477 CGCCCTGGGGAGAGGGAGGAGGG - Intergenic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107035845 13:35901697-35901719 GGGCCTGAGGAGAAGGATGGAGG - Intronic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1109870390 13:68324750-68324772 AGGCCTGAGGAGAGGGAGAGAGG + Intergenic
1110467141 13:75814916-75814938 TGGCTGGAGCAGAGGGAGTGGGG + Intronic
1111384439 13:87505689-87505711 AGGCCTGAGCAGAGACAGAGAGG + Intergenic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112810527 13:103213400-103213422 TGGCCTGAACAGAGGCAGCGAGG - Intergenic
1113255415 13:108499965-108499987 CCGCCGGAGCAGAGGGAGAGAGG - Intergenic
1113489422 13:110679641-110679663 GGGCGTGACCGGAGGGAGGGAGG + Intronic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113713068 13:112483616-112483638 AGGGCTGAGAAGAGGGAGAGAGG + Intergenic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1113814859 13:113162942-113162964 GGACCTGAGCAGGAGGAGGGTGG - Intronic
1113835678 13:113326870-113326892 AGGCCACAGCAGCGGGAGGGAGG + Intronic
1113901879 13:113802220-113802242 TGGCCTGGGCAGGAGGAGGGAGG + Intronic
1117031383 14:51674549-51674571 AGTGCTGAGCAGAGGTAGGGTGG + Intronic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1117648918 14:57882101-57882123 TGGGCTGATGAGAGGGAGGGAGG - Intronic
1118176711 14:63447881-63447903 AGGCCTGAGAAGAGGGACAGAGG + Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119731410 14:76953607-76953629 CTGCCTGGGCAGCGGGAGAGTGG - Intergenic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121253257 14:92514529-92514551 CGGCCAGGGCAGAGGGGCGGCGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121409309 14:93738217-93738239 CAGCCTGTGCCAAGGGAGGGAGG - Intronic
1122043949 14:99010220-99010242 TGGCCAGAGCAGGAGGAGGGCGG + Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122816576 14:104316948-104316970 TGGGCAGAGCAGAGGCAGGGAGG + Intergenic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1123777664 15:23596857-23596879 CCACCTGAGCACTGGGAGGGCGG - Intronic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124560432 15:30768986-30769008 AGGCCTGAGGAGAGGGAGACCGG + Intronic
1124593587 15:31075721-31075743 TGAGCTGGGCAGAGGGAGGGAGG + Intronic
1124670779 15:31636455-31636477 AGGCCTGAGGAGAGGGAGACAGG - Intronic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1125822751 15:42646940-42646962 AGGCCTGAGTAGAGGGAGAAAGG + Intronic
1126110853 15:45173914-45173936 TGGCCTGGTCAGAGGGAGGGAGG + Intronic
1126339447 15:47623060-47623082 GGGCTTCAGGAGAGGGAGGGGGG - Intronic
1128043979 15:64600672-64600694 GGGCGGGAGAAGAGGGAGGGAGG + Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128360752 15:66959971-66959993 TGGGCTGAGAAGAGGGAAGGAGG - Intergenic
1128371405 15:67042238-67042260 CTACCTGAGGAGGGGGAGGGGGG + Intergenic
1128548474 15:68582967-68582989 AGGCCTTAGGAGAGGGAGTGTGG + Intronic
1128589323 15:68880736-68880758 AGGCCTGATGAGAAGGAGGGGGG + Intronic
1128842912 15:70864524-70864546 TGGCCAGAGCAGAGGGAGTGAGG - Intronic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129761190 15:78130275-78130297 TGGCATGGGCAGAGGGAGAGAGG + Intronic
1129884272 15:79027678-79027700 GGGCCCCAGCAGCGGGAGGGAGG - Intronic
1132101180 15:99024503-99024525 CGCCCTCAGCGGAGGGAGTGGGG + Intergenic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132648565 16:1010222-1010244 CGGCCTGAGGGGAGTGTGGGGGG + Intergenic
1132781566 16:1629271-1629293 CTGCCTGTGCAGAGACAGGGAGG - Intronic
1132878073 16:2149024-2149046 CGGCCTGAGCCAAGGGTTGGGGG + Intronic
1132887888 16:2190410-2190432 CGGCCTGAGGGCAGGGAGAGGGG + Intronic
1132888573 16:2193564-2193586 CTGCCTCAGCTGTGGGAGGGAGG - Intronic
1132900424 16:2251288-2251310 CGGGCGGCGCCGAGGGAGGGCGG - Intronic
1133234925 16:4383265-4383287 CGGAAAGAGCAGAGGGAGAGCGG + Exonic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1133978840 16:10619038-10619060 AGGCCTTGGCAGAGGGAGGAGGG + Intergenic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134118432 16:11566741-11566763 CAGCCTGGGCAGGGGTAGGGGGG + Intronic
1135156733 16:20059158-20059180 CGGGCTTAGCAAAGAGAGGGAGG - Intronic
1135930377 16:26731241-26731263 AGGACAGGGCAGAGGGAGGGAGG - Intergenic
1135992066 16:27224334-27224356 CACCCTGAGCAGTGGGTGGGGGG + Intergenic
1136248577 16:28989288-28989310 AGGGCTGTGGAGAGGGAGGGAGG - Intronic
1136673732 16:31880323-31880345 GCACCTTAGCAGAGGGAGGGTGG + Intronic
1136682996 16:31978754-31978776 TGGCTTGGGCTGAGGGAGGGTGG + Intergenic
1136783636 16:32922310-32922332 TGGCTTGGGCTGAGGGAGGGTGG + Intergenic
1136886154 16:33931496-33931518 TGGCTTGGGCTGAGGGAGGGTGG - Intergenic
1137448612 16:48549764-48549786 GGGCCTGGGCAGAGGGATGGGGG - Intronic
1138199565 16:55078704-55078726 GGGCCTGGGCAGAAGGAAGGAGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139259393 16:65577434-65577456 TGAGCTGAGCAGAGGGAGTGGGG + Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139999225 16:71009867-71009889 CGGAGGGAGCAGAGGGAGAGTGG + Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1140225217 16:73071399-73071421 GGCCTTGAGCGGAGGGAGGGAGG + Intergenic
1140504556 16:75463566-75463588 GGACCAGAGCAGAGGGAAGGAGG - Intronic
1140512101 16:75516349-75516371 GGACCAGAGCAGAGGGAAGGAGG - Intergenic
1140927927 16:79600555-79600577 CGACTGGAGGAGAGGGAGGGGGG + Exonic
1141663806 16:85455501-85455523 CGGCCTGAGCATGGGGTGTGAGG - Intergenic
1142186771 16:88698436-88698458 GGGCCCGAGCAGGAGGAGGGTGG + Intronic
1203086282 16_KI270728v1_random:1186304-1186326 TGGCTTGGGCTGAGGGAGGGTGG + Intergenic
1143118610 17:4594050-4594072 AGGTCTGAGCAGGGGGAGTGAGG + Intronic
1143174884 17:4949975-4949997 CGGCCTGAGATGAGGGGGCGGGG + Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143719362 17:8799138-8799160 AGGCCTGGGCCGACGGAGGGCGG + Exonic
1143720556 17:8806123-8806145 CTGCATGAGCTGGGGGAGGGTGG + Intronic
1144573904 17:16417109-16417131 AGGGGTGAGGAGAGGGAGGGAGG - Intronic
1144902101 17:18604655-18604677 ATGCCTTAGCAGAGGGTGGGAGG + Intergenic
1145253177 17:21307536-21307558 GGGTCAGAGGAGAGGGAGGGAGG + Intronic
1145323393 17:21780382-21780404 GGGTCAGAGGAGAGGGAGGGAGG - Intergenic
1145996364 17:29107038-29107060 GGGCCTGGGCAGAGGGAGAGCGG + Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146115498 17:30134125-30134147 AGGCCTGAGGAGAGGGAGAGAGG + Intronic
1146268396 17:31468249-31468271 GGGTCTGAGCAGAGGAAGCGAGG - Intronic
1147143901 17:38474463-38474485 TGGCTTGGGCTGAGGGAGGGTGG + Intronic
1147983177 17:44287873-44287895 AGGCATGAGTAGAGGGAGAGTGG - Intergenic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148755702 17:49971969-49971991 CGACCTGAGCCGAGAGAGAGCGG - Intronic
1150060499 17:62065103-62065125 CGGCGGGCGCCGAGGGAGGGGGG - Intronic
1150124481 17:62627620-62627642 CAGCCCGGGCGGAGGGAGGGCGG - Exonic
1151295724 17:73184915-73184937 AGGCCAGAGTAGAGTGAGGGAGG + Intergenic
1151382371 17:73734739-73734761 GGAACAGAGCAGAGGGAGGGAGG - Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152005490 17:77677783-77677805 GGGCCGGAGCAGAGAGAGAGAGG - Intergenic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152368500 17:79870844-79870866 GGGCCTGAGCAGTGGGTGGGAGG + Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152590407 17:81208836-81208858 AGGGCAGAGCAGAGGCAGGGAGG + Intronic
1153757871 18:8301972-8301994 CTGCCGGAGCAGCGGGAGTGGGG + Intronic
1154485034 18:14866456-14866478 CAGCCTGAGCTGTAGGAGGGTGG + Intergenic
1154494261 18:14944347-14944369 AGGGAAGAGCAGAGGGAGGGAGG - Intergenic
1154978392 18:21481220-21481242 AGGCCTGGGCAGGGGGATGGGGG + Intronic
1155045812 18:22102039-22102061 AGGCCTGGGGTGAGGGAGGGAGG + Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156248757 18:35330460-35330482 AGGCCTCAGCACAGGGAGGGTGG - Intergenic
1156463576 18:37335005-37335027 AGGGGGGAGCAGAGGGAGGGAGG - Intronic
1157513691 18:48296175-48296197 GGGCCTGAGCAGGTGGTGGGGGG - Intronic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159710435 18:71751404-71751426 TGGCCAGAGAAGAGGGAGTGTGG + Intronic
1160037124 18:75311521-75311543 CGGCCTGAGCAGCAGGCGGTGGG - Intergenic
1160295478 18:77633241-77633263 GGGCCTGGGCAGAGGCAGGGGGG - Intergenic
1160313682 18:77821016-77821038 CGGGCTGTGCAGAGTGTGGGGGG + Intergenic
1160357265 18:78238982-78239004 CGGCCTGAGAAGAAGGAAGGAGG + Intergenic
1160758793 19:772136-772158 TGGCTGGAGCAGAGGAAGGGGGG - Intergenic
1160906461 19:1453793-1453815 CGGGCTGGGGAGGGGGAGGGAGG - Intronic
1160984524 19:1832176-1832198 CGCCCTGAGCCGAGGGATGCAGG + Intronic
1161087013 19:2340011-2340033 CGCCCCGTGCGGAGGGAGGGTGG + Intronic
1161116406 19:2499302-2499324 CATCTGGAGCAGAGGGAGGGAGG - Intergenic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161238815 19:3210713-3210735 TGGCTCGAGCAGAGGGAGTGAGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161498145 19:4598448-4598470 GGGCCCGAGGAGAGGGAGGGAGG - Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161852741 19:6746089-6746111 CGGCCGGAGCGGGGGGACGGGGG - Intronic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162776609 19:12983635-12983657 CGGCCCGCGCGCAGGGAGGGCGG - Intergenic
1162786870 19:13040530-13040552 GCTCCTGAGGAGAGGGAGGGAGG - Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1163407011 19:17129046-17129068 TGGCCTGAGCAGGGGGGTGGAGG + Intronic
1163670862 19:18627682-18627704 CCGCCAGAGCAGAGGGAGTGAGG - Intergenic
1164834547 19:31349264-31349286 CGGGCTGAGGACAGGGAGGGAGG + Exonic
1165162951 19:33828725-33828747 TGGCCTGAGCAAAGGAAGGATGG + Intergenic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165838848 19:38774831-38774853 AGGCCTGGGCAGAGGCAGGCTGG + Intergenic
1165840607 19:38787309-38787331 AGGCCTGGGCAGAGGCAGGCTGG - Intergenic
1165902968 19:39177412-39177434 CTACCTGGGCTGAGGGAGGGAGG + Intronic
1166130498 19:40742981-40743003 TGGCCTGAGCACAGGGGAGGTGG + Intronic
1166340765 19:42135314-42135336 GGGACTGGGCAGAGGGAGGTGGG - Intronic
1166513292 19:43425691-43425713 GGGGCAGTGCAGAGGGAGGGAGG + Intergenic
1166840068 19:45691936-45691958 CTGCCTGAGGAGAGAGAGGCGGG + Exonic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1167842308 19:52131958-52131980 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167896668 19:52587345-52587367 TGGCTGGAGCAGAGGGAGTGAGG - Intergenic
1167906109 19:52661997-52662019 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167945109 19:52981839-52981861 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
1168549416 19:57280653-57280675 GGGGCTGAGGAGACGGAGGGCGG - Exonic
1168553676 19:57320677-57320699 GGGGCTGAGGAGACGGAGGGCGG - Exonic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925811213 2:7702779-7702801 TGCCCTGAGCTGAGGCAGGGAGG - Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
927510888 2:23643009-23643031 TGGCCTGAGATGGGGGAGGGAGG + Intronic
927860832 2:26559034-26559056 GGGCATGAGCATAGGTAGGGTGG + Intergenic
928022597 2:27715967-27715989 GGGCGTGGGCAGGGGGAGGGAGG - Intergenic
928657237 2:33464904-33464926 AGGCCTGAGGAGAGGAAGAGAGG - Intronic
928803678 2:35125434-35125456 CTCCCTGAGCAGGGGAAGGGCGG + Intergenic
929423200 2:41816185-41816207 TGGCCAGAGCAGAGGGAGTATGG + Intergenic
929668904 2:43853946-43853968 CCACCTGAGCACAGGGAGGGAGG - Intronic
929842182 2:45479157-45479179 AGGCCCCAGGAGAGGGAGGGAGG - Intronic
930142253 2:47964397-47964419 GGCCAGGAGCAGAGGGAGGGAGG + Intergenic
930192992 2:48479317-48479339 CTCCCTGAGCTGTGGGAGGGAGG + Intronic
930583146 2:53236659-53236681 AGACCTGAGGAGAGGGAGAGAGG - Intergenic
930879954 2:56259415-56259437 AGGCCTGAGCCCAGCGAGGGAGG - Intronic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
932046776 2:68357804-68357826 CGGCCTGTGCACTGGGAGGATGG - Intergenic
932144206 2:69304781-69304803 CTGCCTGATCTGAGGGTGGGTGG + Intergenic
932599374 2:73113100-73113122 CGGCCTCTGCAGAGGGTGGGCGG + Intronic
933124432 2:78586544-78586566 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
933639202 2:84741276-84741298 GGGCCTGAAAACAGGGAGGGCGG + Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
933819291 2:86095086-86095108 CAGCCAGAGCAGAGTGAGAGGGG - Intronic
934049785 2:88200432-88200454 CGGCTTGGGCAGAGGAAGTGCGG - Intergenic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935738252 2:106123938-106123960 GGGCCTGAGCAGGTGCAGGGAGG + Intronic
936245216 2:110820539-110820561 AGGTCTGAGGAGAGGGAGTGGGG + Intronic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
937046222 2:118853462-118853484 CGGACTGAGCGGAGGGGTGGGGG - Intergenic
937344892 2:121119415-121119437 AGGACTGAGCAGGGCGAGGGTGG - Intergenic
938259129 2:129882772-129882794 GGGCAGGAACAGAGGGAGGGAGG - Intergenic
938562950 2:132490710-132490732 AGGCCTGAACAGGGTGAGGGAGG + Intronic
938708657 2:133956302-133956324 CGGGGAGAGCAGAGGTAGGGTGG - Intergenic
938919827 2:135985335-135985357 CGGGCTGCGCCGAGGGAGGGAGG - Intronic
939056749 2:137374143-137374165 TGGCATGAGGGGAGGGAGGGAGG + Intronic
940551893 2:155169378-155169400 CGTCCTGTGTAGAGGGAGTGGGG - Intergenic
941520230 2:166533218-166533240 AACACTGAGCAGAGGGAGGGAGG - Intergenic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
946622428 2:221573540-221573562 CGGCCTGGGAAGGGGAAGGGAGG - Intronic
946757174 2:222959513-222959535 CAGCCTGAGGCGAGGGAGCGTGG - Intergenic
947188024 2:227472304-227472326 CGGCGCGCGCAGACGGAGGGCGG + Exonic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947748545 2:232521615-232521637 TGGCCTGTGCAAAGGCAGGGAGG + Intronic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948491456 2:238315679-238315701 AGGCCTGAGGAGAGGTTGGGTGG + Intergenic
948613182 2:239182310-239182332 AGCTCTGAGCAGCGGGAGGGAGG - Intronic
948892605 2:240914738-240914760 CTGCCTGAGCTGGGGGCGGGAGG - Intergenic
948910828 2:241001830-241001852 AGCCCTGAGCAGAGGCAGGGAGG + Intronic
1169071161 20:2731480-2731502 TGGCATGAGCAGAGGTAAGGTGG - Intronic
1169083930 20:2815519-2815541 GGGCCTGTGGAGAGAGAGGGTGG - Exonic
1169191382 20:3660861-3660883 AGGCCTGCGCGGCGGGAGGGCGG + Exonic
1169195331 20:3679625-3679647 GGGACAAAGCAGAGGGAGGGGGG + Intronic
1169424519 20:5485637-5485659 GAGCCTGAACAGAGGGAGAGGGG + Intergenic
1171978245 20:31608774-31608796 CGGGCCTCGCAGAGGGAGGGGGG + Intergenic
1172291487 20:33780270-33780292 TGGCCAGAGCAGAGTGAGTGAGG + Intronic
1172628195 20:36360731-36360753 GGGCCTGAGCAGAGCATGGGGGG + Intronic
1173576392 20:44115365-44115387 GAGCCTGAGCAGCTGGAGGGTGG - Intronic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1173942076 20:46919952-46919974 AGGCCTGAGCAGAGGGAGAGAGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174175822 20:48644370-48644392 CGGCCTGTGCTCAGGGAGAGAGG - Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174544132 20:51312587-51312609 CTGCCTGAGCACTGGGAGGATGG - Intergenic
1174574343 20:51526071-51526093 CGGGCTGAGCAGATGCAGGAAGG - Intronic
1174600567 20:51721087-51721109 TGCCCTGAGAAGAGGAAGGGAGG - Intronic
1175402544 20:58708724-58708746 GGGCCTGGGCAGAGGCAAGGAGG - Intronic
1176011727 20:62900440-62900462 GGGCCTGAGCAGAGACGGGGAGG + Intronic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176723766 21:10413684-10413706 CGGCCTGAGCGGTAGGAGTGGGG + Intergenic
1176796294 21:13373019-13373041 CAGCCTGAGCTGTAGGAGGGTGG - Intergenic
1176796316 21:13373119-13373141 CGGCCTGAGCGGTAGGAGGGGGG - Intergenic
1176796324 21:13373139-13373161 TGGCCTGAGCGGTAGGAGGGCGG - Intergenic
1177377943 21:20298346-20298368 CCCCCTTATCAGAGGGAGGGTGG - Intergenic
1178100534 21:29264050-29264072 AGGCCTGAAGAGAGGGAGAGAGG + Intronic
1178265751 21:31141605-31141627 AGGACTGAGCAGAGAGTGGGTGG + Intronic
1178272022 21:31199480-31199502 AGGCCTGGGCAGGGGGAGGGTGG - Intronic
1178318454 21:31586683-31586705 TGGCCTGAGCAAAGGACGGGGGG - Intergenic
1179396304 21:41043485-41043507 TGGCCAGAGCAGAAGGAAGGTGG + Intergenic
1179411681 21:41167855-41167877 CGGCCTGAGCCCGGCGAGGGTGG + Exonic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1179780186 21:43694633-43694655 AGGCCTGAGCAGAGCGTGGCTGG - Exonic
1179789799 21:43749757-43749779 CCACCACAGCAGAGGGAGGGTGG + Intronic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1179951321 21:44710336-44710358 CGGGCTGTGCAGTGGGAGGTAGG - Intronic
1179958133 21:44752323-44752345 CGGGCTGAGCAGAGGGTGAGGGG - Intergenic
1180086843 21:45511457-45511479 CGCCATGAGCAGAGGGCCGGGGG - Intronic
1180304931 22:11066525-11066547 CAGCCTGAGCGGTAGGAGGGTGG + Intergenic
1180550157 22:16531679-16531701 AGGGCTGAGCAGAGTCAGGGCGG - Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1182294371 22:29304568-29304590 AGGGCTGAGCACTGGGAGGGCGG - Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182438337 22:30345834-30345856 GGGCCTCAGCACAGGGAAGGTGG + Intronic
1182445367 22:30386773-30386795 GGCCATGAGCAGAGGGAGGTAGG + Intronic
1182455253 22:30446338-30446360 TGGCCTGAGCAAAGGCAGGGAGG - Intergenic
1182753127 22:32657592-32657614 CGGGCAGAGCAGAGTGGGGGTGG + Intronic
1182754299 22:32666423-32666445 TGGCCAGAGCAGAGTGAGAGAGG - Intronic
1183091789 22:35527196-35527218 AGGCAGGAGAAGAGGGAGGGGGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183715286 22:39529720-39529742 AGCCCTGAGCATAGGGTGGGAGG - Intronic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184277681 22:43419517-43419539 GGGCCTGAGAAGTGGGAGTGGGG + Intronic
1184536992 22:45094195-45094217 TAGCCTGAGCAGCGGGAGGGTGG - Intergenic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1184880784 22:47303116-47303138 AGGCCTGAGTAGAGGGTGGGAGG + Intergenic
1185243633 22:49761051-49761073 GGGCCTGAGACCAGGGAGGGCGG - Intergenic
1185245583 22:49771243-49771265 CGGCTTGAGCGTGGGGAGGGTGG - Intergenic
949284696 3:2388417-2388439 TGGCCAGAGTAGAGGAAGGGAGG - Intronic
950260064 3:11537058-11537080 GGCCCTGTGCAGAGGGATGGAGG - Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
953978033 3:47397049-47397071 GAGCCTGAGGAGAGGGAGAGAGG + Intronic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954333096 3:49901189-49901211 TGTACTCAGCAGAGGGAGGGAGG + Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
955136392 3:56222978-56223000 CTCCCTGAGCAGATAGAGGGAGG - Intronic
956678882 3:71759582-71759604 CGGCCTGAGGAGAGAGTGGGAGG - Intergenic
957053249 3:75426238-75426260 GCGGCTCAGCAGAGGGAGGGAGG - Intergenic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
960955475 3:123027771-123027793 CCGCGGGAGCAGAAGGAGGGAGG + Intronic
961222440 3:125211821-125211843 CGCCCTGAGCAGAGGGGAGAGGG + Intronic
961479166 3:127168453-127168475 CTGCCAGAGCTGAGGGAGGGAGG + Intergenic
961603723 3:128078501-128078523 GTGGCTGAGGAGAGGGAGGGAGG - Intronic
961654155 3:128432484-128432506 TGGCCTGGGCAGCGGGAGTGTGG + Intergenic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962826230 3:139102728-139102750 TTGCCTGAGCAGAGGGAGCAAGG + Intronic
964006801 3:151839578-151839600 CAGCCTGGGCTGAGAGAGGGAGG + Intergenic
964404007 3:156329598-156329620 TGGCCTGAGAGGAGTGAGGGAGG + Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
966821532 3:183928659-183928681 CGGCCAGAGCAGACGGGGTGTGG + Intronic
967055232 3:185824734-185824756 CGGCCTGAGCGGGGCGAGGCGGG + Intronic
967826447 3:193881509-193881531 CTACCTGAGCAGAGAGAGGAAGG - Intergenic
968542001 4:1172545-1172567 CGGCAGGAGCAGCGGGAGCGCGG + Exonic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969456248 4:7301355-7301377 GGGCCTGTGCTGAGGGTGGGTGG - Intronic
969517275 4:7654707-7654729 CAGGCTGAGCAGTGGAAGGGGGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970518367 4:16857909-16857931 TGGGCTGAGGGGAGGGAGGGAGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972629689 4:40832631-40832653 TGGCCTGAGCACAGGCAGGGAGG - Intronic
973710574 4:53626222-53626244 AGGACTGAGCAGAGGTGGGGTGG + Intronic
973737964 4:53891142-53891164 AGCCCTGAGCAGAGGCAAGGAGG + Intronic
975101647 4:70520974-70520996 TGGCCAGAGCAGAGTGAGGGAGG + Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
976828850 4:89290306-89290328 TGGCCTGAGCAGAGGAATGCAGG - Intronic
976911454 4:90312234-90312256 TGGCATGAGCAGAGTGATGGAGG + Intronic
979254884 4:118599227-118599249 CGGCCTGAGTGAGGGGAGGGAGG - Intergenic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984490685 4:180431072-180431094 AGGCCTGAGCACAGGGAGTAAGG - Intergenic
984715072 4:182917472-182917494 AGCCCTGAGGGGAGGGAGGGAGG + Intronic
985328325 4:188797620-188797642 GGGCCTGTGGAGAGGGAGGGAGG - Intergenic
985827663 5:2204945-2204967 GGGCCTGGGTAGAAGGAGGGAGG + Intergenic
985879695 5:2628855-2628877 CTCCCTGTGCAGGGGGAGGGAGG - Intergenic
985887156 5:2688598-2688620 ACTCCTGAGCTGAGGGAGGGGGG - Intergenic
985973410 5:3394789-3394811 AGGCTGGAGAAGAGGGAGGGAGG - Intergenic
986300671 5:6476174-6476196 GGGCCTGAGCAGGGAGGGGGTGG + Intronic
986575797 5:9211570-9211592 CAGCCTGAGCACAGCTAGGGTGG - Intronic
987000685 5:13656256-13656278 AGGCCTGAGAAGAGGCAAGGAGG + Intergenic
987058640 5:14220348-14220370 AGGCCTGAGGAGAGGGAGAGAGG - Intronic
987668861 5:20982602-20982624 CGGCCCAAGGAGAGGGAGAGAGG + Intergenic
988228282 5:28442857-28442879 AGGCCTGAGAAGCGGGAGAGTGG + Intergenic
990131434 5:52590604-52590626 CGGCTTGGGCAGAGAGTGGGAGG + Intergenic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
994106312 5:95953087-95953109 CGGGCTGAGCAGAGGATGGCAGG + Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
994961054 5:106603352-106603374 AGGCTTGAGGAGAGGGAGAGCGG - Intergenic
995376467 5:111479908-111479930 AGGCATGAGAAGAGGCAGGGAGG - Intronic
995855140 5:116584006-116584028 AGGTCTGAGCAGACGGAAGGAGG - Intergenic
996595081 5:125191455-125191477 CGGATTGAGAGGAGGGAGGGAGG - Intergenic
996754927 5:126925681-126925703 CCCACTGAGCTGAGGGAGGGGGG + Intronic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
997702273 5:135911100-135911122 CGACCTGGGCAGTGGGAAGGAGG + Intergenic
998040885 5:138950436-138950458 AGGCGTGTGCAGAGGGAGTGAGG + Intronic
998176412 5:139904572-139904594 CGGCCCGAGCCGGTGGAGGGGGG - Intronic
1001429139 5:171645832-171645854 GGGCCTGGGCTGAGGGAGGAAGG + Intergenic
1001542040 5:172546399-172546421 TGACCTGAGCAGAGTGAGCGAGG + Intergenic
1002100871 5:176856929-176856951 TGGCCTGGGCAGAGTGAGTGAGG - Intronic
1002321762 5:178380699-178380721 CGGCCGGGACAGAGGCAGGGAGG + Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002427589 5:179185363-179185385 CCGCCTGAGCAGGGAGAGGCTGG + Intronic
1002434368 5:179221861-179221883 GGGCTGGAGCAGAGGGAAGGAGG - Intronic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1002522024 5:179797368-179797390 CGGCCTGATCCTAGGAAGGGGGG + Intergenic
1002723727 5:181281641-181281663 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002723789 5:181281837-181281859 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002723798 5:181281877-181281899 CGGCCTGAGCCGTAGGAGGGTGG + Intergenic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1006187322 6:32188856-32188878 GGGCCTGAGAACAAGGAGGGAGG + Intronic
1006517099 6:34551202-34551224 TGGCCTGAGCAGAGGCAAAGGGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006910223 6:37558763-37558785 CGGCCCGAGCTGGGGGCGGGAGG - Intergenic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007625508 6:43244031-43244053 GGGACTGAGGACAGGGAGGGAGG - Intronic
1007680360 6:43629250-43629272 CGGCCTGAGCAGAGTGGGGTGGG + Intergenic
1007756459 6:44102755-44102777 AGGCCTGGGCTGAGGCAGGGAGG - Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008268911 6:49466112-49466134 AGGCCTAAGGAGAGGGAGAGAGG + Intronic
1008916834 6:56797278-56797300 GGGCCTGAGGAAAGGGAGAGAGG - Intronic
1009733709 6:67646435-67646457 AGGCCTGAGGAGAGAGAGAGAGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014369301 6:120584507-120584529 CTCCCTGAGCAGGGGAAGGGTGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015503137 6:133953472-133953494 CGGCCTGAGCACCGGGTGCGGGG + Intronic
1016054540 6:139565679-139565701 TGGCCAGAGCAGGAGGAGGGTGG + Intergenic
1016652456 6:146478352-146478374 CTACTTGAGCAGAGGGTGGGAGG - Intergenic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017645565 6:156537007-156537029 TGGCCAGAGCAGAAGGAGGTAGG + Intergenic
1017788415 6:157774793-157774815 TGGCCTGGGGAGAGGGAGAGAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018906801 6:168080277-168080299 GGATCTGAGCGGAGGGAGGGAGG - Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019284896 7:218521-218543 AAGCCTGGTCAGAGGGAGGGCGG + Intronic
1019470693 7:1219001-1219023 TGGCCTGAGTAGAGGCTGGGTGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019629192 7:2037771-2037793 AGGCCCAAGGAGAGGGAGGGAGG - Intronic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1020254930 7:6497728-6497750 CGGCCTGAGCAGGGAGATGGAGG - Intronic
1021824540 7:24535834-24535856 CGGCCTGAGCACAGGAAGCATGG - Intergenic
1021906392 7:25338478-25338500 CAGCCTGAGCAGGGGAATGGGGG + Intergenic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1022710562 7:32845256-32845278 CGACATGAGCAGGGAGAGGGAGG + Intergenic
1023477071 7:40592435-40592457 CGCCCTGAGCAGAGGGATTGTGG + Intronic
1023667154 7:42535793-42535815 GGGCTTGAGGAGAGGGAGGGAGG - Intergenic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026822207 7:73557377-73557399 CGGCCGGCGCTGGGGGAGGGGGG - Intronic
1026877613 7:73888384-73888406 TGGACTGGGCAGGGGGAGGGAGG + Intergenic
1028752067 7:94393647-94393669 CGGCCAGAGAAGAGGGAAGTTGG + Intergenic
1029423599 7:100483942-100483964 CGCCCGGAGCAGGAGGAGGGAGG - Exonic
1030083043 7:105793809-105793831 TGGCCTGATCACAGGCAGGGAGG + Intronic
1030097077 7:105909943-105909965 CCACTTGAGCAGAGGCAGGGAGG + Intronic
1030174130 7:106632801-106632823 GGGCCTGATAAGAGGGAGGCCGG - Intergenic
1030425995 7:109379139-109379161 AGGCCTGAGGAGAGGGAGACAGG - Intergenic
1030643394 7:112031436-112031458 AGGACAGAGAAGAGGGAGGGAGG - Intronic
1032180886 7:129676484-129676506 AGGCCTGAGGAGTGGGAGAGAGG + Intronic
1032240846 7:130157665-130157687 AGAACTGAGCAGAGCGAGGGCGG + Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032784342 7:135188619-135188641 CAGCCTGAGTAGAGGGTGAGGGG - Intronic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033235803 7:139637006-139637028 CTGCCTAAGCAGCTGGAGGGTGG - Intronic
1033654387 7:143362868-143362890 CGGCCGGAGCAGGGGCGGGGAGG - Intergenic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1034428573 7:151028282-151028304 CGCCCAGAGCAGGGGGCGGGCGG + Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1035090992 7:156310162-156310184 GGGGCTGAGCAGAGTGTGGGGGG - Intergenic
1035224990 7:157428028-157428050 CGTCCCCAGCAGAGGGAGGAGGG + Intergenic
1035587164 8:785559-785581 GGGCCTGAGGGGAGGGAGGCCGG - Intergenic
1035629656 8:1097799-1097821 TCTCCTGAGCAGAGGGAGGTGGG - Intergenic
1035658852 8:1331823-1331845 AGGCAGGAGCAGAGGGAGAGTGG + Intergenic
1036645980 8:10611642-10611664 CGGCCTGAGCAAGGGGCGGTGGG - Exonic
1036750896 8:11443259-11443281 CAGCCTGAGAACAGGGTGGGGGG - Intronic
1037309802 8:17543299-17543321 CGACCTGAGCAGAAGGGAGGAGG - Exonic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1038033310 8:23663497-23663519 GGGCCTAAGCAAAGGCAGGGAGG - Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1039921451 8:41896771-41896793 CCGCCGCAGGAGAGGGAGGGAGG - Intergenic
1040903336 8:52439568-52439590 AGGCCTGAGCAGAGGCACGTGGG + Intronic
1041586431 8:59525583-59525605 AGACCTGAGGAGAGGGAGAGAGG - Intergenic
1045345180 8:101287657-101287679 GGCCTTGAGCAGAGGGTGGGGGG - Intergenic
1047540187 8:125757489-125757511 AGGCCTGCACAGAGGGAGAGTGG - Intergenic
1047827874 8:128597478-128597500 AGGCCTGAGGAGAGAGAAGGAGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048276692 8:133071394-133071416 AGGCCTGAGGAAAGGGATGGAGG + Intronic
1048318624 8:133380947-133380969 GGGCTAGAGCGGAGGGAGGGAGG + Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1049037466 8:140087560-140087582 TGGCCTGAGCAGCTGGACGGTGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049311409 8:141935764-141935786 AGGCCTCAGCAGAAGGTGGGTGG - Intergenic
1049313264 8:141945094-141945116 AGCCCTGTGCTGAGGGAGGGAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049628289 8:143636442-143636464 CGGCCTGGGCTCAGGGCGGGGGG - Intronic
1049720039 8:144111508-144111530 GGGCCTGAGCCGGGGCAGGGCGG - Intronic
1049814462 8:144591672-144591694 CGGCCTGAGCACCTGGAGGGCGG + Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1052862046 9:33443266-33443288 GGTCCTGAACAGAGGGACGGGGG + Intronic
1053198152 9:36136027-36136049 CCGCCTGAGGAAAGGCAGGGAGG + Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056477506 9:86967255-86967277 CGGCCAGAGCAGGAGGAAGGGGG - Intergenic
1057147858 9:92770508-92770530 CGGCCTCAGCAGAGGTGGGAGGG + Intergenic
1057519702 9:95751530-95751552 GGGCCTGAGCTGTGGGAGGGAGG + Intergenic
1057519830 9:95751924-95751946 GGGCCTGAGCTGCAGGAGGGAGG + Intergenic
1058007879 9:99938819-99938841 GGACCTGATAAGAGGGAGGGAGG + Intronic
1059418539 9:114176762-114176784 AGCCCTGAGCAGAAGGAGGAGGG - Intronic
1059459132 9:114418614-114418636 AGGCCAGAGCAGAGGGAGTACGG - Intronic
1059572506 9:115454774-115454796 AGGCCTGAGGAGAGGGTGAGAGG + Intergenic
1060549205 9:124477197-124477219 GGGGCTGAGCAGTGGCAGGGTGG + Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060766461 9:126297855-126297877 GTGGCTGAGCAGAGGGCGGGTGG - Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1061291649 9:129653798-129653820 AGGGCTGAGCAGCGGGAGGCAGG + Intergenic
1061355836 9:130104214-130104236 CGGCCTGTGCAGATTCAGGGGGG + Intronic
1061452919 9:130678310-130678332 TGGCCTGGGCAGGGAGAGGGGGG + Intronic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061774041 9:132948774-132948796 CGGCCTAAGCCAAGGTAGGGCGG - Intronic
1061917670 9:133763630-133763652 GGGGCTGAGCAGAGGGTGTGGGG + Exonic
1061989735 9:134152458-134152480 AGGCCTGAGGAGAGGAAGGAGGG + Intronic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1062123633 9:134847906-134847928 TGGCCTGAGCAGAGATGGGGAGG + Intergenic
1187724931 X:22192552-22192574 TGGCCGGAACAGAAGGAGGGAGG - Intronic
1188348096 X:29093319-29093341 TGGCCAGAGCAGGAGGAGGGGGG + Intronic
1189251008 X:39600719-39600741 CGGCCTGGGCAGGGGAAGGAGGG + Intergenic
1189373986 X:40452047-40452069 CTGCCTGAACCGAGGGAGAGTGG + Intergenic
1192199895 X:69060226-69060248 GGGGCTTAGCAGAGGGAAGGGGG + Intergenic
1196599229 X:117583040-117583062 TGGCCAGAGCAGAAGGAGAGGGG - Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1199970399 X:152855712-152855734 GGCCATGAGCAGAGGCAGGGAGG - Intronic
1200094395 X:153650399-153650421 CGGCCTGAGCAGGGTGCTGGGGG + Exonic