ID: 920915923

View in Genome Browser
Species Human (GRCh38)
Location 1:210257930-210257952
Sequence CTGCAGCTTGAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920915923_920915929 19 Left 920915923 1:210257930-210257952 CCTGGCTCCTTCTCAAGCTGCAG No data
Right 920915929 1:210257972-210257994 CTCAATCTGACAGCATCCCAAGG No data
920915923_920915930 20 Left 920915923 1:210257930-210257952 CCTGGCTCCTTCTCAAGCTGCAG No data
Right 920915930 1:210257973-210257995 TCAATCTGACAGCATCCCAAGGG No data
920915923_920915931 21 Left 920915923 1:210257930-210257952 CCTGGCTCCTTCTCAAGCTGCAG No data
Right 920915931 1:210257974-210257996 CAATCTGACAGCATCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920915923 Original CRISPR CTGCAGCTTGAGAAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr