ID: 920918205

View in Genome Browser
Species Human (GRCh38)
Location 1:210275800-210275822
Sequence GTGTAAATACATGTAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920918205_920918213 28 Left 920918205 1:210275800-210275822 CCCAGCTTTACATGTATTTACAC No data
Right 920918213 1:210275851-210275873 TGGTGGTTTACATCTCCAAAAGG No data
920918205_920918209 8 Left 920918205 1:210275800-210275822 CCCAGCTTTACATGTATTTACAC No data
Right 920918209 1:210275831-210275853 GGCCTCTTTTACACATTGCCTGG No data
920918205_920918211 11 Left 920918205 1:210275800-210275822 CCCAGCTTTACATGTATTTACAC No data
Right 920918211 1:210275834-210275856 CTCTTTTACACATTGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920918205 Original CRISPR GTGTAAATACATGTAAAGCT GGG (reversed) Intergenic
No off target data available for this crispr