ID: 920923181

View in Genome Browser
Species Human (GRCh38)
Location 1:210315278-210315300
Sequence GAAGGAACTCACCAAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923181_920923184 18 Left 920923181 1:210315278-210315300 CCTTTGATTTGGTGAGTTCCTTC No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data
920923181_920923185 30 Left 920923181 1:210315278-210315300 CCTTTGATTTGGTGAGTTCCTTC No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923181 Original CRISPR GAAGGAACTCACCAAATCAA AGG (reversed) Intergenic