ID: 920923182

View in Genome Browser
Species Human (GRCh38)
Location 1:210315296-210315318
Sequence TAATATTTGCTGGATAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923182_920923185 12 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data
920923182_920923184 0 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data
920923182_920923187 29 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923187 1:210315348-210315370 TCTAGGTGCTACTGGAGATCAGG No data
920923182_920923186 21 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923186 1:210315340-210315362 GGCACATTTCTAGGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923182 Original CRISPR TAATATTTGCTGGATAAAGA AGG (reversed) Intergenic