ID: 920923183

View in Genome Browser
Species Human (GRCh38)
Location 1:210315306-210315328
Sequence CAATAAATATTAATATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923183_920923185 2 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data
920923183_920923186 11 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923186 1:210315340-210315362 GGCACATTTCTAGGTGCTACTGG No data
920923183_920923187 19 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923187 1:210315348-210315370 TCTAGGTGCTACTGGAGATCAGG No data
920923183_920923184 -10 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923183 Original CRISPR CAATAAATATTAATATTTGC TGG (reversed) Intergenic