ID: 920923183

View in Genome Browser
Species Human (GRCh38)
Location 1:210315306-210315328
Sequence CAATAAATATTAATATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923183_920923187 19 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923187 1:210315348-210315370 TCTAGGTGCTACTGGAGATCAGG No data
920923183_920923184 -10 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data
920923183_920923186 11 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923186 1:210315340-210315362 GGCACATTTCTAGGTGCTACTGG No data
920923183_920923185 2 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923183 Original CRISPR CAATAAATATTAATATTTGC TGG (reversed) Intergenic
No off target data available for this crispr