ID: 920923184

View in Genome Browser
Species Human (GRCh38)
Location 1:210315319-210315341
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923181_920923184 18 Left 920923181 1:210315278-210315300 CCTTTGATTTGGTGAGTTCCTTC No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data
920923183_920923184 -10 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data
920923182_920923184 0 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923184 1:210315319-210315341 ATATTTATTGAAGATGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type