ID: 920923185

View in Genome Browser
Species Human (GRCh38)
Location 1:210315331-210315353
Sequence GATGTACTAGGCACATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923182_920923185 12 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data
920923181_920923185 30 Left 920923181 1:210315278-210315300 CCTTTGATTTGGTGAGTTCCTTC No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data
920923183_920923185 2 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923185 1:210315331-210315353 GATGTACTAGGCACATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923185 Original CRISPR GATGTACTAGGCACATTTCT AGG Intergenic
No off target data available for this crispr