ID: 920923186 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:210315340-210315362 |
Sequence | GGCACATTTCTAGGTGCTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
920923183_920923186 | 11 | Left | 920923183 | 1:210315306-210315328 | CCAGCAAATATTAATATTTATTG | No data | ||
Right | 920923186 | 1:210315340-210315362 | GGCACATTTCTAGGTGCTACTGG | No data | ||||
920923182_920923186 | 21 | Left | 920923182 | 1:210315296-210315318 | CCTTCTTTATCCAGCAAATATTA | No data | ||
Right | 920923186 | 1:210315340-210315362 | GGCACATTTCTAGGTGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
920923186 | Original CRISPR | GGCACATTTCTAGGTGCTAC TGG | Intergenic | ||