ID: 920923186 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:210315340-210315362 |
| Sequence | GGCACATTTCTAGGTGCTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920923182_920923186 | 21 | Left | 920923182 | 1:210315296-210315318 | CCTTCTTTATCCAGCAAATATTA | No data | ||
| Right | 920923186 | 1:210315340-210315362 | GGCACATTTCTAGGTGCTACTGG | No data | ||||
| 920923183_920923186 | 11 | Left | 920923183 | 1:210315306-210315328 | CCAGCAAATATTAATATTTATTG | No data | ||
| Right | 920923186 | 1:210315340-210315362 | GGCACATTTCTAGGTGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920923186 | Original CRISPR | GGCACATTTCTAGGTGCTAC TGG | Intergenic | ||
| No off target data available for this crispr | |||||