ID: 920923187

View in Genome Browser
Species Human (GRCh38)
Location 1:210315348-210315370
Sequence TCTAGGTGCTACTGGAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920923183_920923187 19 Left 920923183 1:210315306-210315328 CCAGCAAATATTAATATTTATTG No data
Right 920923187 1:210315348-210315370 TCTAGGTGCTACTGGAGATCAGG No data
920923182_920923187 29 Left 920923182 1:210315296-210315318 CCTTCTTTATCCAGCAAATATTA No data
Right 920923187 1:210315348-210315370 TCTAGGTGCTACTGGAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920923187 Original CRISPR TCTAGGTGCTACTGGAGATC AGG Intergenic
No off target data available for this crispr