ID: 920924872

View in Genome Browser
Species Human (GRCh38)
Location 1:210331342-210331364
Sequence AGACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 2, 1: 20, 2: 31, 3: 43, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920924870_920924872 16 Left 920924870 1:210331303-210331325 CCTACTTCATAGTCTCATTTTGG 0: 1
1: 0
2: 2
3: 25
4: 283
Right 920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG 0: 2
1: 20
2: 31
3: 43
4: 228
920924869_920924872 20 Left 920924869 1:210331299-210331321 CCAGCCTACTTCATAGTCTCATT 0: 1
1: 0
2: 3
3: 30
4: 219
Right 920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG 0: 2
1: 20
2: 31
3: 43
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920924872 Original CRISPR AGACCCTGCTTCACAAAGAT AGG Intronic
901134621 1:6984936-6984958 GGACCCTGCTTCCCAGAGAAAGG + Intronic
902492079 1:16790170-16790192 AGACCCTGCTTCCCAGAGGCAGG - Intronic
902642643 1:17776542-17776564 AGACTCAGCTTCACAGAGAGGGG - Intronic
904632630 1:31854241-31854263 AGACCCTGTCTCAAAAAAATAGG + Intergenic
904703517 1:32373528-32373550 AGACCCTGTCTCAAAAAAATAGG - Intronic
904971729 1:34424369-34424391 AGACCCCTGTTCACAGAGATGGG - Intergenic
905247799 1:36626977-36626999 AGGCCCTGCTCTACTAAGATAGG - Intergenic
905265055 1:36746664-36746686 AGACCCTGTTTCAAAAAAAAAGG + Intergenic
907804912 1:57808975-57808997 AGACGCTGCTTCACAGACTTTGG + Intronic
908552216 1:65220818-65220840 AGTCCCTGTTTTACAAAAATGGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910589030 1:88909243-88909265 AGCCCCTGCTGCCCAAATATGGG - Intergenic
910820956 1:91345685-91345707 TGACCATGCTTCACACAGAAAGG - Intronic
911729576 1:101278935-101278957 AGAGCATGCTTCACAGAGACAGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
914856282 1:151353288-151353310 AGACCCTGTCTCAAAAAAATAGG + Intergenic
914858056 1:151366377-151366399 AGACCCTGTCTCTAAAAGATGGG - Exonic
915632431 1:157162825-157162847 AGATCCACCTTCACAATGATGGG - Intergenic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918081270 1:181209504-181209526 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
918550760 1:185739655-185739677 AGACCTTGCTTCACATAAAAGGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920564438 1:206962168-206962190 AGAACGTGCTTCACCAAGCTTGG + Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921727079 1:218535569-218535591 AGACCCTGTTTCAAAAATAAAGG - Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923465711 1:234246397-234246419 AGGCCCTGCTTCTCAGAGAAAGG - Intronic
923528367 1:234792367-234792389 AGACCCTGCTTCCCAGAGGCAGG + Intergenic
923558399 1:235020221-235020243 ACACCCTGCTTCTTAAAGGTAGG + Intergenic
923757610 1:236807181-236807203 AGACCCTGCCTCAAAAAAAAAGG - Intronic
923888838 1:238188530-238188552 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
924052237 1:240091329-240091351 AGACCCTGCTTCTCCAGGAGAGG - Intronic
924206150 1:241713299-241713321 AGACCCTGTCTCAAAAAGAAAGG + Intronic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924504496 1:244669008-244669030 AGACCCTGTCTCACAAAAAAGGG - Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065788852 10:29241757-29241779 AGACCCTGCCTCAAGAAGAAGGG + Intergenic
1065824455 10:29557103-29557125 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1067167420 10:43876817-43876839 AGACCCTGGTTCACACAGGACGG + Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068453255 10:57221372-57221394 AGACCATGCTGCATATAGATTGG + Intergenic
1069095671 10:64256832-64256854 AGACACTGCTCCTCAAAGAGCGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1072759039 10:98040753-98040775 AGACCCTGTCTCAAAAAGAGAGG + Intergenic
1073757728 10:106598762-106598784 AGGCCCTGCTTAACAAATAAAGG - Intronic
1074442994 10:113495075-113495097 AGACCCTTCTTGAGAAAGAAGGG + Intergenic
1077449395 11:2627758-2627780 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080652415 11:34233259-34233281 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1081861143 11:46333937-46333959 AGACCCTGCTGCCCAGAGATGGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084674825 11:70628267-70628289 GGATCCTGCCACACAAAGATGGG - Intronic
1085027781 11:73247510-73247532 GGACTGTGCTGCACAAAGATGGG + Intergenic
1087296245 11:96378049-96378071 AGACCCTATTTCACAAATTTGGG - Intronic
1088057177 11:105598501-105598523 AGGCCCTACTTCAGAAAGACAGG + Intergenic
1090439193 11:126712350-126712372 AGACCCTGCCTCACTCAGAGAGG - Intronic
1090532473 11:127605269-127605291 AGACCCTGCCACACAAAAAAAGG - Intergenic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1091180491 11:133600055-133600077 GGACCCTGCTTCTGCAAGATGGG - Intergenic
1091660073 12:2376824-2376846 CCTCCCTGCTTCACAGAGATGGG + Intronic
1094291956 12:28861094-28861116 AGACCCTGCCTCAAAAAAAACGG - Intergenic
1094653897 12:32402386-32402408 AGACCCTGTCTCAAAAAGAGAGG + Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1098331554 12:69358995-69359017 AGACACTGCTTCAGAAGGATGGG - Intergenic
1099814257 12:87624947-87624969 AGACCCTGTCTCACAAAAAAAGG + Intergenic
1100383894 12:94087776-94087798 AGAGCCTGCTTCCCAAAGAAAGG - Intergenic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1103452021 12:121035865-121035887 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1104971058 12:132530878-132530900 AGACCCTGGTGCATACAGATGGG + Intronic
1106293673 13:28390403-28390425 AGACCCTGATTCAAAAAAAAAGG - Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1106855795 13:33851235-33851257 ATTTCCTGCTTTACAAAGATTGG + Intronic
1108946251 13:56028444-56028466 AGACCCTGCTTGTAAAATATGGG + Intergenic
1109589427 13:64458883-64458905 AGACCATGCTTCAAAAAGCAGGG - Intergenic
1112735561 13:102412658-102412680 AGACTCAGATTCACAAAGAATGG + Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1115201687 14:30860780-30860802 AGACCCTGTCTCAAAAAAATCGG - Intergenic
1115254263 14:31381774-31381796 AGACCCTGTTTCAAAAAAAGGGG + Intronic
1115982895 14:39073298-39073320 AGACTCTGTTTCAAAAAGAAGGG - Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118615170 14:67570016-67570038 AGAAACTGCTGCACAAAGAGGGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1122098050 14:99386040-99386062 ACACCCTGCTTCATGAAGACGGG + Intergenic
1122186007 14:99996659-99996681 AGACCCTGCCTCAAAAAAAAAGG - Intronic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1126657667 15:50996702-50996724 AGACCATTCTTCAGAAAGTTTGG + Intronic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1128297283 15:66534109-66534131 AGACCCTGTTTCAAAAAAAAGGG + Intronic
1128583498 15:68826471-68826493 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1129181336 15:73878996-73879018 AGACCCTGCTTCCCAGGGTTAGG + Intronic
1131013489 15:89038757-89038779 AGACCCTGCCTCAGAAAAAAAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1135104228 16:19633524-19633546 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1138767424 16:59621146-59621168 AGACTCTTCTTCCCAAATATGGG - Intergenic
1139437711 16:66946160-66946182 AGACCCTGCCTCAAAAAAATAGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1142795177 17:2302241-2302263 AGACCCTGCCTCAAAAAAATTGG + Intronic
1145199734 17:20932700-20932722 AGACCCTGCCTCAAAAACAAAGG - Intergenic
1146110130 17:30082058-30082080 AGACCCTGTTCCACAGAGAAGGG - Intronic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1149420908 17:56510406-56510428 AGAGCCTGCTTCACAGGCATAGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150712701 17:67545300-67545322 AGACCCTGCTTCTAAAATATGGG + Intronic
1151199389 17:72456520-72456542 AGACGGTGCTTCCCAAAGTTTGG + Intergenic
1151283091 17:73091046-73091068 AGACCCTGATTCAGAAAGTCTGG - Intronic
1151422537 17:74007877-74007899 AGACCCAGCTACTCAAAGAGTGG + Intergenic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1153748591 18:8206827-8206849 AGACTCTGCTTCAAAAAAAAGGG + Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1157315350 18:46583032-46583054 AGACTCTGTTACACAGAGATTGG + Intronic
1157558443 18:48628994-48629016 AGACCCAACTTCTCAAAGACAGG - Intronic
1157637550 18:49174614-49174636 ATTCCCTGAGTCACAAAGATTGG + Intronic
1157771652 18:50352962-50352984 AGACCCTGCCTCAAAAAAAAAGG + Intergenic
1157965330 18:52202514-52202536 ACACCCTGCCTCACAACAATTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1159806023 18:72959191-72959213 GGACCCTGCTTCATATAGCTAGG + Intergenic
1160341490 18:78092994-78093016 AGTGCATGCTTCACATAGATTGG + Intergenic
1160878224 19:1307752-1307774 AGACCCTGTCTCATAAAGAAGGG - Intergenic
1160925792 19:1544849-1544871 AGACCCTGTCTCAGAAAGAAAGG - Intergenic
1162828276 19:13267788-13267810 AGACCCTGCCTCAAAAAAAAAGG - Intronic
1166277621 19:41765686-41765708 AGACCCTGCTTCACTCTCATGGG - Intronic
1166323722 19:42036360-42036382 AGACCCTGTTTTAAAAAAATAGG - Intronic
1168042642 19:53770478-53770500 AGACCCTGTCTCAAAAAGAAAGG + Intergenic
1168299682 19:55396887-55396909 AGACCTTGCCTCAGAAAGAAAGG - Intronic
1168718131 19:58540767-58540789 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718424 19:58541966-58541988 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718566 19:58542549-58542571 AGACCCTGCTTCCCTCAGACAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927429570 2:23015791-23015813 AGAGCCTGCTTCAAATGGATTGG - Intergenic
928035061 2:27815215-27815237 AGACCCTGTCTCAAAAAGAGGGG - Intronic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928228130 2:29472279-29472301 TGCCCCTGCTTCACAATGACTGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929505174 2:42522727-42522749 AGACCCTGTCTCAGAAAGATGGG + Intronic
932590698 2:73065109-73065131 AGACCCTGTCTCAGAAAGAAGGG - Intronic
932904828 2:75738510-75738532 AGACCAGGCTTCACACAGCTGGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933740366 2:85529252-85529274 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
935030789 2:99320015-99320037 AGACCCTGTCTCAAAAAGAAAGG - Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
943165372 2:184316193-184316215 AGAAGCTGCTTCAAAATGATGGG - Intergenic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
945207876 2:207351476-207351498 TGACCATGCTTCACACAGAAAGG + Intergenic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
946677252 2:222173884-222173906 AGACTCTGCCTTACAAAGAAGGG - Intergenic
946830094 2:223720010-223720032 ATACCCTGCTTCCCAAATGTTGG - Intergenic
1169300877 20:4440988-4441010 AGACCCTGTCTCACAAAAGTGGG - Intergenic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1171154682 20:22861080-22861102 AGACCCTTCATTCCAAAGATAGG - Intergenic
1171493245 20:25537094-25537116 AGACCCTGTTTCAAAAACAAAGG - Intronic
1172950482 20:38720246-38720268 AGTCCTTGCTTCACAAGGCTTGG + Intergenic
1173161813 20:40658485-40658507 AGACCCTGCCTGATACAGATAGG + Intergenic
1173422485 20:42914911-42914933 AGCCCCTGCCTCACACAGATTGG - Intronic
1174098759 20:48110430-48110452 AGACCCTGCTTCTAAAAAAGTGG - Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176164682 20:63666543-63666565 AGACCCTGTTTCAAAAAAAAGGG - Intronic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179462472 21:41547026-41547048 ACCCCCTGCCTCACAAAGCTGGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
949308623 3:2671705-2671727 AGACCTTTCCCCACAAAGATGGG - Intronic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
949708960 3:6852611-6852633 AGACCATGATTCCCAAAGAAGGG - Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951919127 3:27834195-27834217 AGACCTTACTTCACAATGAAAGG + Intergenic
952734412 3:36674548-36674570 AGACCCTGCACCACCCAGATTGG - Intergenic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
954258936 3:49425049-49425071 AGACCCTGCTCCAGAAGGAGGGG + Exonic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
954776954 3:53028098-53028120 AGACCCTGTCTCAAAAAGAGTGG - Intronic
955444826 3:58998607-58998629 ATATCCTCCTCCACAAAGATAGG - Intronic
955488925 3:59463209-59463231 AGACTCTGCTTTTCTAAGATGGG - Intergenic
956426140 3:69137660-69137682 AGACCCTGCCTCAAAAAAAGGGG - Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962586051 3:136843634-136843656 AGACCCTGTTTCAAAAAGGCTGG + Intronic
963308274 3:143678347-143678369 AGACTCTTCTTAACAAAGAATGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964252551 3:154735382-154735404 AGACCCTGCATCAGAACAATGGG + Intergenic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
967202198 3:187082046-187082068 AGACCCTGTCTCAAAAAGAATGG - Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
968146653 3:196304889-196304911 AGACCCTGCCTCAGATAGGTAGG - Intronic
969187486 4:5487347-5487369 AGACTTGGCATCACAAAGATTGG + Intronic
970066422 4:12099475-12099497 AGACCTTGCATGACAAAGAAAGG - Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
971929986 4:33069071-33069093 TGAACCTGCTTCACAAAATTGGG + Intergenic
973301039 4:48584654-48584676 ATACCCTGTATCACACAGATAGG - Intronic
974120960 4:57638783-57638805 AGACCATGCTTCTCAAACTTGGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977540187 4:98308458-98308480 AGACCCTGTCTCAGAAAGAAAGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978522755 4:109633798-109633820 AGACCGTGCTTGACAATAATTGG + Intronic
979388931 4:120103858-120103880 AGATCCTGCCTATCAAAGATGGG + Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980701431 4:136437103-136437125 AGACACTGCCTCTCAATGATAGG + Intergenic
981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG + Intergenic
984750803 4:183271994-183272016 AGACCCTGTCTCAAAAAAATGGG + Intronic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987117693 5:14739003-14739025 AGACCCTGCCTCATGAAGTTTGG + Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
997859282 5:137401732-137401754 AGACCCTGACTCAAAAAGAAAGG + Intronic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998846493 5:146315466-146315488 AGTACCTGCTTCACAGGGATAGG - Intronic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1001961351 5:175882058-175882080 AGGCCCTGCTCCCCAAAGAAGGG - Exonic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1006383954 6:33718500-33718522 AGCCCCTGCTCCACAGAGATGGG + Intergenic
1006969667 6:38028852-38028874 ATGCCTTGCTTCACAAAGAAAGG - Intronic
1007413469 6:41678582-41678604 AGACCCTGCCTCAAAAACAAGGG + Intergenic
1008879970 6:56371907-56371929 AGTCCCTGCTCCACAGAGCTGGG + Intronic
1009480522 6:64152581-64152603 TGACCCTGCTTCTAAAAGCTAGG - Intronic
1010051710 6:71512163-71512185 AGACCCTGAGTCAGGAAGATTGG + Intergenic
1010424569 6:75713088-75713110 AGACCCTGCCTGAAAAAAATGGG + Intronic
1011283671 6:85702275-85702297 AGACCCTGTTTCAAAAAGGAAGG - Intergenic
1011513021 6:88122369-88122391 AGACCTTGCTCCACAAAGTCAGG - Intergenic
1012239318 6:96854177-96854199 AGACACTGCTTGAAAAATATAGG - Intergenic
1012954098 6:105549614-105549636 AGACCCTGATTCATACAGGTTGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014512528 6:122341824-122341846 AGGCCCTGCTACACAAAGTGTGG - Intergenic
1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG + Intergenic
1016841358 6:148528711-148528733 AGTCCCTGGTGCAAAAAGATTGG - Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019668229 7:2263480-2263502 GGACCCTGCTGCTCAAAGAGTGG + Intronic
1019782762 7:2953866-2953888 AGACCCAACTTCACAAGGCTTGG - Intronic
1020036349 7:4965552-4965574 AGACCCTGTCTCAAAAAAATGGG - Intergenic
1020218207 7:6212141-6212163 AGACCTTGCTTCAAAAAAAATGG - Intronic
1020561768 7:9737060-9737082 TGACCTTGCTTCAAAAAGACTGG - Intergenic
1022922170 7:35026582-35026604 TGACACTGCTTCTCAAAGTTTGG - Intronic
1026306551 7:69147455-69147477 AGACCCTGTCTCAAAAAGAGTGG + Intergenic
1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG + Intronic
1026967092 7:74447099-74447121 AGACCCTACCTCAAAAAGAAAGG - Intergenic
1029101260 7:98132094-98132116 AGGCCCTGCTTGCCAAAGACAGG + Intronic
1029133311 7:98350094-98350116 AGACCCTGCCTCAAAAAGGGGGG + Intronic
1029528457 7:101109607-101109629 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1030213311 7:107018014-107018036 AGAGCCTGCTTGACAATGAATGG - Intergenic
1030959418 7:115897188-115897210 AGACCTTGCTTCCTAAATATAGG + Intergenic
1031893755 7:127324413-127324435 GGACTCTGCTTGACAAGGATGGG - Intergenic
1034684477 7:152958142-152958164 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
1035526699 8:318407-318429 AGACCCTGCTGGACAGAGAAAGG - Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1036669010 8:10767691-10767713 AGATCCTGCCTCCCAAAGACGGG + Intronic
1037603072 8:20414996-20415018 AGACACAGACTCACAAAGATTGG + Intergenic
1038199046 8:25394875-25394897 AGTCCCTGTGTCAAAAAGATTGG - Intronic
1038792854 8:30684053-30684075 AGACCCTCCCTCACCAAGAAGGG + Intronic
1039975861 8:42364247-42364269 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG + Intergenic
1043290155 8:78588889-78588911 AGACCCTGTCTCAAAAAGAAAGG + Intronic
1043932996 8:86111825-86111847 AGACCCAGATCCATAAAGATAGG - Intronic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1047175468 8:122536558-122536580 AGAACTTGCTTGAAAAAGATGGG - Intergenic
1047809913 8:128397137-128397159 TGACCATGCTTCACATAGAAAGG - Intergenic
1049124258 8:140772413-140772435 AGACCCTGTCTCGCCAAGATGGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1052125753 9:24772748-24772770 ACACCCTGCTTCATAAAGGTTGG - Intergenic
1052161793 9:25271354-25271376 TGAGACTTCTTCACAAAGATGGG - Intergenic
1054937601 9:70705295-70705317 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1054939292 9:70723288-70723310 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1055265145 9:74486658-74486680 AGACCATGGTTGTCAAAGATAGG + Intergenic
1057214859 9:93222176-93222198 AGACCCTGCCTCAAAAAAAGGGG - Intronic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058388514 9:104466788-104466810 AGACCCTGTTCCTCCAAGATTGG + Intergenic
1058620516 9:106878152-106878174 TGACCCAGGTTCACAAAGCTAGG - Intronic
1203793527 EBV:163990-164012 AGACCCGGCCCCTCAAAGATGGG + Intergenic
1185763298 X:2704721-2704743 AGACCCTGCCTCCAAAAAATAGG - Intronic
1186394405 X:9193692-9193714 AGACCCTGCCTCTAAAAAATAGG - Intergenic
1187348915 X:18493923-18493945 AGACCCTGCCTCAATAAAATAGG - Intronic
1187448351 X:19376453-19376475 AGACCCTGTCTCAAAAAGTTGGG - Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188246239 X:27839369-27839391 AAACCCTGCTTTGTAAAGATAGG - Intergenic
1189211748 X:39289686-39289708 ATAACCTACTTCACAAAGTTAGG + Intergenic
1191719719 X:64219373-64219395 AGACCCTGCCTCACACAGTCTGG - Intergenic
1192186369 X:68949375-68949397 TGACCCTACTTGACACAGATGGG - Intergenic
1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG + Intergenic
1194589726 X:95784995-95785017 ACACCCAGCTTTCCAAAGATTGG - Intergenic
1195698651 X:107685355-107685377 ATGCCCTGCTTCCCAAAGCTTGG + Intergenic
1197577268 X:128230709-128230731 AGACCCTGTTCTACAAATATGGG + Intergenic
1199405452 X:147453261-147453283 AGACCATGCTTCAGAAACAGTGG - Intergenic
1199933045 X:152544472-152544494 AGACTCTACCTAACAAAGATGGG + Intergenic
1200539642 Y:4442680-4442702 ACACTCTGTTTCACAGAGATAGG + Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic