ID: 920925204

View in Genome Browser
Species Human (GRCh38)
Location 1:210334589-210334611
Sequence TATTACCCACAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920925204_920925209 5 Left 920925204 1:210334589-210334611 CCCTGCTCCTTCTGTGGGTAATA 0: 1
1: 0
2: 0
3: 13
4: 164
Right 920925209 1:210334617-210334639 GGAGAATATTCCTGAAATAGTGG 0: 1
1: 0
2: 0
3: 11
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920925204 Original CRISPR TATTACCCACAGAAGGAGCA GGG (reversed) Intronic
902325292 1:15696169-15696191 TATTAAGCTCACAAGGAGCAGGG + Intronic
902898431 1:19495824-19495846 TGTTACCAAAAGAAGGAGAAGGG + Intergenic
904917308 1:33979446-33979468 TGGTACCCACAGTAGGAGGAAGG - Intronic
905142505 1:35859314-35859336 TATCTCCCAAAGAAGGAGTAAGG - Intergenic
906772794 1:48500257-48500279 TATCACACAGAGGAGGAGCAGGG + Intergenic
909263110 1:73520399-73520421 TATTGCCCAAAGAAGGAAAAAGG + Intergenic
910561271 1:88594464-88594486 TATCAACCAAAAAAGGAGCATGG + Intergenic
912945370 1:114080002-114080024 TTTTGCCCACAGAAGGAGAAAGG - Intergenic
915938828 1:160105534-160105556 TATTGTCCTCAGAAGGAGCTGGG + Intergenic
918192162 1:182186082-182186104 TATTATCCTCAAAAGCAGCAGGG + Intergenic
919421801 1:197378896-197378918 TAGTACCCAGAGCAAGAGCATGG + Intronic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
923972497 1:239219952-239219974 TTTCACCCACACAAGGTGCAAGG - Intergenic
924600041 1:245480513-245480535 TATAACCCACAGAAGCACGAGGG - Intronic
1066054825 10:31671051-31671073 GATTAACTACTGAAGGAGCATGG + Intergenic
1068285849 10:54933703-54933725 TATTACTCACCTAAGGTGCATGG - Intronic
1068807147 10:61209840-61209862 TATTATCACCATAAGGAGCATGG - Intergenic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1072639451 10:97200489-97200511 GATAAGGCACAGAAGGAGCACGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073662631 10:105493701-105493723 TATGACACACAGAAGGACTAGGG - Intergenic
1074587476 10:114782394-114782416 AACTACCCACAGAAAGAGCAAGG + Intergenic
1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG + Intronic
1075904926 10:126072786-126072808 TATTACTTAGAGAGGGAGCAGGG + Intronic
1076803922 10:132845855-132845877 TACTACCCCCACAAGGACCAGGG + Intronic
1078567912 11:12433026-12433048 TAATACCCATAGAAGAAGCTAGG + Intronic
1079128353 11:17734304-17734326 CATTACCCATGGAAGGAACATGG + Intergenic
1079556854 11:21769486-21769508 AATTACCCACAGAAGTAGTCAGG - Intergenic
1081561953 11:44225927-44225949 TATTATCCACAGAAGGCTCATGG + Intronic
1083258859 11:61512489-61512511 TCTTAGACACAGAAGCAGCAGGG + Intergenic
1083687586 11:64385871-64385893 TATTAACAACAGCAGCAGCAGGG - Intergenic
1084601581 11:70148971-70148993 TATTCCCAACAGACAGAGCATGG - Intronic
1084719787 11:70897306-70897328 TATAACCCACAAAAGGAGCCAGG + Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1085875478 11:80402243-80402265 GATTACCCACATATGGAGAACGG - Intergenic
1086140337 11:83492004-83492026 TAGTACCTACGGAATGAGCATGG - Intronic
1088323922 11:108582730-108582752 TAGTGCCCCCAGAGGGAGCATGG - Intronic
1089479635 11:118793545-118793567 TATAACCTACAAAAGGAGCCCGG + Intergenic
1090303574 11:125670378-125670400 TATTACACATAGAAAAAGCAGGG - Intronic
1091463520 12:664043-664065 GATTAGCCATAGAGGGAGCAGGG + Intergenic
1091664794 12:2411463-2411485 TTTAGCCCACAGAAGGAGCAGGG - Intronic
1091701659 12:2667320-2667342 TATTGCCCCAACAAGGAGCACGG - Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1095106152 12:38235366-38235388 TATTACCCCCAGAAGGGTCTGGG - Intergenic
1097483692 12:60165703-60165725 TATTACACACAAAATCAGCAAGG + Intergenic
1100371696 12:93974648-93974670 TCTGACCCCAAGAAGGAGCATGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1117259028 14:54009892-54009914 TATTCCCCTCACTAGGAGCAAGG + Intergenic
1120597215 14:86455916-86455938 TTTTACCCACAATAGGACCATGG + Intergenic
1120984608 14:90323313-90323335 TATTACACATAGAGGGAGGAAGG + Intronic
1121829814 14:97040968-97040990 TATTACTCACAGAAGAACAATGG - Intergenic
1122290867 14:100679776-100679798 GATTACCGACAGAAGGAGAAAGG + Intergenic
1125163801 15:36679076-36679098 TAATACACACAGAAGTAGAAAGG + Intronic
1125267630 15:37901450-37901472 TATCACCTTCAGAGGGAGCATGG - Intergenic
1125537878 15:40453032-40453054 CATTCCCCACAGCAGGAGCCCGG - Intronic
1126135859 15:45390358-45390380 TATTACAAAAAGAAGGAGCTAGG + Intronic
1126434731 15:48624888-48624910 TACCACCCACAGAAGGAACTGGG + Intronic
1127834461 15:62779439-62779461 TAGCACCCACAAAAGGAGGAAGG + Intronic
1128142173 15:65309984-65310006 TGTTAGCCACGGGAGGAGCACGG - Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129366972 15:75062202-75062224 CATGACTCACAGAAAGAGCAAGG - Intronic
1131040242 15:89257864-89257886 CATTCTCCACACAAGGAGCAAGG + Intronic
1135039573 16:19107684-19107706 CATTTCCCACAGTGGGAGCAGGG - Intergenic
1138827348 16:60336397-60336419 TATTACACACAGAAGTTTCAGGG - Intergenic
1139397950 16:66655459-66655481 TATTTCCCACTAAAGGAACAGGG + Intronic
1140710448 16:77672534-77672556 TACTTCCCAGGGAAGGAGCAAGG + Intergenic
1140862661 16:79032040-79032062 TATTACATACAGAAGGAGGCAGG - Intronic
1141437637 16:84009456-84009478 TAGAGCCCACAGAGGGAGCATGG + Intergenic
1141635650 16:85312667-85312689 TATTCACTACAGAAGAAGCAGGG + Intergenic
1141851380 16:86648527-86648549 TGTTGCCCACAGAAGGGGCCTGG - Intergenic
1144121773 17:12161768-12161790 TATAACCCACATAGTGAGCACGG + Intergenic
1148949346 17:51296244-51296266 CACTACCAACACAAGGAGCAAGG - Intronic
1149071893 17:52553405-52553427 TCTTAACCACTGAAGAAGCAAGG - Intergenic
1149221965 17:54425330-54425352 CATTACCCAGAAAAGGAGCATGG - Intergenic
1150335018 17:64324524-64324546 ACTTACCCACAGAAGAAGAAAGG + Intronic
1150517750 17:65831807-65831829 AATTACTCACAGAAGGAAAAAGG + Intronic
1153805926 18:8707710-8707732 CATAACCCACTGAAGAAGCAGGG - Intronic
1154035578 18:10798552-10798574 TGTTAACCAGAGAAGCAGCATGG - Intronic
1155356221 18:24956690-24956712 GATTTCTCACAAAAGGAGCAAGG - Intergenic
1155542661 18:26884326-26884348 TAATACCCAGAGAGGGAGAAGGG + Intergenic
1158243234 18:55401630-55401652 TATTCCCCACAAACGGAGAAAGG + Intronic
1158980827 18:62759853-62759875 TATTTCCCAAAGAAAGAGCAAGG - Intronic
1160623085 18:80184442-80184464 TCTCAGCCACAGAGGGAGCAAGG + Intronic
1164522612 19:28990607-28990629 TATGACCTACAGGAGGAGCCAGG + Intergenic
1165186132 19:34023433-34023455 TATTAGGCACGGAAAGAGCATGG + Intergenic
1165315686 19:35053993-35054015 TGAGACCCACAGAAGGAACAGGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
927869962 2:26617096-26617118 ACTTACCCACAGCAAGAGCATGG + Intronic
930967994 2:57355346-57355368 TGTTACCCACATAGTGAGCATGG + Intergenic
933008549 2:77026417-77026439 TTTAACCCACAGAATGATCATGG + Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941251385 2:163169054-163169076 TTTTATCCACAGAATGAGAAGGG - Intergenic
943650960 2:190457173-190457195 TATTACCTACTGAAAGAGCATGG + Intronic
944136448 2:196405124-196405146 TATTACCAACAGGAGGGGCCGGG - Intronic
948128235 2:235580897-235580919 TATTCACCATACAAGGAGCAGGG - Intronic
1170274604 20:14570747-14570769 AATCTCCCACAGAAGGACCAGGG - Intronic
1170649186 20:18224452-18224474 TAGCACCCTCAGAGGGAGCACGG - Intergenic
1174815028 20:53680012-53680034 CATGCCCCTCAGAAGGAGCAGGG + Intergenic
1179729631 21:43360559-43360581 TGGTTCCCACAGGAGGAGCAGGG + Intergenic
1180179444 21:46111496-46111518 GATTCCCCAGAGCAGGAGCACGG - Exonic
949383587 3:3473550-3473572 TCTTGCCCAGATAAGGAGCAAGG - Intergenic
949898121 3:8785468-8785490 AATTACCAACAGTAGCAGCATGG + Intronic
950886075 3:16364014-16364036 TATTAACCAAAGAATGAGCAAGG + Intronic
951145207 3:19218733-19218755 TAGCACCAACAGAGGGAGCAGGG - Intronic
953004405 3:38964733-38964755 TATTGCCAAAAGGAGGAGCATGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
957035925 3:75292885-75292907 TATTGCCCACAGAAGGTTGATGG + Intergenic
961353259 3:126317055-126317077 TGCTACCCAGAGAAGGAGAATGG - Intergenic
964080889 3:152755485-152755507 TAAAACCCACAGAAAGAGGAAGG + Intergenic
965871038 3:173265583-173265605 TATTACGCACAGCATGAACAAGG - Intergenic
976703254 4:87993879-87993901 TAGTACACTCAGAAAGAGCATGG - Intergenic
976780013 4:88748425-88748447 CTTTAACCACTGAAGGAGCAAGG - Intronic
977563043 4:98552504-98552526 TATTGCCCAAAGAAAGACCAAGG - Intronic
980271211 4:130586306-130586328 GATTACCCACTGAAGGGTCAGGG + Intergenic
980847814 4:138344932-138344954 TATTTCCCACATAAGTATCAGGG - Intergenic
982682678 4:158450607-158450629 TATATCCCACAGGAGAAGCATGG - Intronic
983208044 4:164931715-164931737 TACCACCTCCAGAAGGAGCAGGG - Intergenic
985084152 4:186295947-186295969 TAATACCCCGAGAAGGAGGAGGG - Intergenic
985329290 4:188810719-188810741 TGTTAACCACAAAAGGATCATGG + Intergenic
985849541 5:2378645-2378667 CATTACCCTCAGAAGGAGGTGGG - Intergenic
985882842 5:2653568-2653590 GGTTAGACACAGAAGGAGCATGG - Intergenic
992087444 5:73290540-73290562 AAGAACCTACAGAAGGAGCAGGG - Intergenic
993161672 5:84299256-84299278 TAATATCGAAAGAAGGAGCATGG + Intronic
993628829 5:90259023-90259045 TAGAACCCAAAGAATGAGCAGGG - Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1000507055 5:162134152-162134174 TATTTTCTACAGAAGGAGTATGG + Intronic
1001024546 5:168213029-168213051 CATTATCAACAGAAGGATCAAGG - Intronic
1001722991 5:173871776-173871798 AATTAACCACAGAAAGACCAGGG - Intergenic
1001912810 5:175534857-175534879 CAGTGCCCACAGAAGCAGCATGG + Intergenic
1003206454 6:4017178-4017200 TATTAACCACAGTAGGGGTATGG - Intergenic
1004558000 6:16718492-16718514 TTATACCCACAGAAGAACCAAGG + Intronic
1007382227 6:41497948-41497970 TACAGCCCAGAGAAGGAGCAAGG + Intergenic
1007731013 6:43946457-43946479 TTTTCCCCACAGAAGTGGCAAGG + Intergenic
1009606427 6:65874724-65874746 TGTTACCAACTGGAGGAGCATGG + Intergenic
1009937253 6:70248681-70248703 TATTACCAACAAAAGCAGCATGG + Intronic
1010162213 6:72869777-72869799 TATTCCCCACAGGGGGAGCGAGG + Intronic
1011237883 6:85237795-85237817 TCTGACCCACAGAAGCAGTAAGG + Intergenic
1013751703 6:113414687-113414709 AATTACCAACAGAGGGAGCCTGG + Intergenic
1014665531 6:124232195-124232217 TTTTACCCAGAGAATGAGCTGGG - Intronic
1022504320 7:30901007-30901029 TTTTAGCCACGGCAGGAGCAGGG - Intergenic
1022593429 7:31688164-31688186 TATTACCCATAGAATGTGCATGG - Intronic
1023516324 7:41005436-41005458 TATTCCCCAAGGAAGGAGAAGGG + Intergenic
1023679470 7:42670416-42670438 TATTATATACAGAAGAAGCATGG + Intergenic
1024436648 7:49364486-49364508 TAACACCTTCAGAAGGAGCATGG - Intergenic
1027150638 7:75731135-75731157 CAATACCCACTAAAGGAGCAAGG + Intronic
1027512485 7:79100197-79100219 TATTAGCCATAGAAGTAGAATGG + Intronic
1027636152 7:80677374-80677396 TTTTACCCACAGAAGGATACAGG + Intronic
1029327106 7:99819244-99819266 TATTGACCAGAGAAGGAGGAGGG - Intergenic
1029973964 7:104815325-104815347 GATTACCCCCAGCAGGAGAAGGG + Intronic
1030316694 7:108122693-108122715 TATTAAAGACAGCAGGAGCATGG + Intronic
1030412864 7:109203628-109203650 TAGCGCCCACAGAGGGAGCATGG + Intergenic
1030982353 7:116201019-116201041 TAGAACCCTCAGAGGGAGCATGG + Intergenic
1033284878 7:140032827-140032849 TGTTACCCACAGTGGGAACAGGG + Intronic
1036921244 8:12857375-12857397 TATTACCAAAAGAAGAAACAAGG + Intergenic
1038095921 8:24309991-24310013 TATTATCCTCAGCAAGAGCAAGG + Intronic
1040600657 8:48880604-48880626 TAGAGCCCTCAGAAGGAGCAGGG - Intergenic
1045421981 8:102025527-102025549 TATTATGTACAGAAGGAGTAAGG - Intronic
1046039867 8:108889926-108889948 TATTACCCACAAAAGCTGGAAGG - Intergenic
1046349052 8:112981929-112981951 TTTTACCCTAAGAAGGAGAATGG + Intronic
1047424141 8:124730087-124730109 TCTTATCAACAGAAGAAGCAGGG + Intergenic
1057455102 9:95201338-95201360 TGTTAGCCACAGTAGCAGCATGG - Intronic
1057791828 9:98129793-98129815 TATAACCCACAGAAGGGGATCGG - Exonic
1060576901 9:124704188-124704210 TATTACCCACAGAAATTGAAAGG - Intronic
1187157352 X:16733398-16733420 TACCACCCACAGAATGAGGATGG + Intronic
1191857491 X:65639054-65639076 TATTTCCCTCAGGAGGAGCCAGG - Intronic
1195796652 X:108655744-108655766 TATTACCTACAAAAATAGCAAGG - Intronic
1197610115 X:128628694-128628716 TAGTACTCACAAAAAGAGCATGG + Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1199057517 X:143315826-143315848 CATTACTTAGAGAAGGAGCAAGG + Intergenic
1199391016 X:147279067-147279089 TATGACTCACAGAAGAACCATGG + Intergenic
1199811008 X:151348641-151348663 AATCACCCAGAGAAGGAGTAAGG + Intergenic
1201378245 Y:13344826-13344848 TCTGACTCACAGAAGGACCATGG - Intronic
1201898001 Y:19014793-19014815 TAATACCTACAGAGGGAGGAAGG + Intergenic