ID: 920927007

View in Genome Browser
Species Human (GRCh38)
Location 1:210351256-210351278
Sequence GGTCTAAATAGAACAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 9, 2: 23, 3: 65, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920927007_920927014 15 Left 920927007 1:210351256-210351278 CCTCCTTTTGTTCTATTTAGACC 0: 1
1: 9
2: 23
3: 65
4: 257
Right 920927014 1:210351294-210351316 GGTGCCCACCTGCATTAAAGAGG 0: 1
1: 0
2: 3
3: 6
4: 136
920927007_920927011 -6 Left 920927007 1:210351256-210351278 CCTCCTTTTGTTCTATTTAGACC 0: 1
1: 9
2: 23
3: 65
4: 257
Right 920927011 1:210351273-210351295 TAGACCCTCAATGGATTGGATGG 0: 1
1: 1
2: 18
3: 55
4: 152
920927007_920927010 -10 Left 920927007 1:210351256-210351278 CCTCCTTTTGTTCTATTTAGACC 0: 1
1: 9
2: 23
3: 65
4: 257
Right 920927010 1:210351269-210351291 TATTTAGACCCTCAATGGATTGG 0: 2
1: 10
2: 79
3: 233
4: 589
920927007_920927015 16 Left 920927007 1:210351256-210351278 CCTCCTTTTGTTCTATTTAGACC 0: 1
1: 9
2: 23
3: 65
4: 257
Right 920927015 1:210351295-210351317 GTGCCCACCTGCATTAAAGAGGG 0: 1
1: 0
2: 2
3: 30
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920927007 Original CRISPR GGTCTAAATAGAACAAAAGG AGG (reversed) Intronic
902279007 1:15360832-15360854 TGTGTAACAAGAACAAAAGGGGG - Intronic
905049381 1:35036681-35036703 GGCCAGAATAGAACAAAAGGTGG + Intergenic
905430187 1:37916853-37916875 GGAGGAAATAGAGCAAAAGGAGG - Intronic
906079731 1:43077370-43077392 GCTCTCCATTGAACAAAAGGTGG - Intergenic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
908936128 1:69378292-69378314 GGCCCCAATAGAACAAAAAGTGG + Intergenic
909009262 1:70315231-70315253 GCTCTAAAGAAAAAAAAAGGAGG - Intronic
909166184 1:72228287-72228309 GGCCTTAAGAGAACAAAAGTTGG + Intronic
909238812 1:73185321-73185343 GGTCTGAATAGAACAAAATGTGG + Intergenic
909308080 1:74106954-74106976 GGTCAGAATAGAAGAAATGGAGG - Intronic
910141837 1:84034615-84034637 GGTCTGTATAGAACAAAAGGAGG + Intergenic
910486754 1:87723420-87723442 GGCCTCAATAGAGCAAAAGGTGG + Intergenic
911376647 1:97059567-97059589 TGTGTAAATAGAATAAAAGGGGG + Intergenic
913088956 1:115463247-115463269 GGGCAAAATAGAAGGAAAGGAGG + Intergenic
913374364 1:118134198-118134220 AGTCTAAATTTAGCAAAAGGGGG + Intronic
914744649 1:150492886-150492908 GGTCTCAAAAAAAAAAAAGGGGG - Intronic
914888785 1:151604634-151604656 GGGTTAAAGAGAACAAAAAGGGG - Intergenic
915432346 1:155876554-155876576 GGGATAAAGAAAACAAAAGGAGG - Intronic
916327392 1:163578294-163578316 GGCCTGAATAGAACAAAAGGTGG + Intergenic
916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG + Intergenic
918995974 1:191760165-191760187 ATTCTAATTAGAACAAAGGGTGG - Intergenic
919058574 1:192602008-192602030 GGGCTATCTAGAACAAAAGTGGG - Intergenic
920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG + Intronic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
921334573 1:214073488-214073510 GATCTCAAGAGACCAAAAGGGGG + Intergenic
922387202 1:225098895-225098917 GGTCTAAAGAAAAGAAAAAGTGG + Intronic
922766922 1:228160755-228160777 GGCCTGAACAGAACCAAAGGTGG - Intergenic
923576581 1:235164025-235164047 CGTCTCAAAAAAACAAAAGGAGG + Intronic
924360242 1:243232766-243232788 GGTGTTACTAGAACAACAGGAGG + Intronic
1063260062 10:4377902-4377924 CGTCTAAACAAAAAAAAAGGCGG - Intergenic
1063816730 10:9783876-9783898 AATCTAAAGAAAACAAAAGGTGG - Intergenic
1063816933 10:9786375-9786397 GGCCTGAATAGAACAAGAAGTGG - Intergenic
1063923863 10:10958342-10958364 GGGGAAAATAGAACAAACGGTGG + Intergenic
1064259012 10:13769739-13769761 GGCTTGAATAGAACAAAAGATGG + Intronic
1064520179 10:16192628-16192650 AGCCCAAATAGAACAAACGGTGG - Intergenic
1065752568 10:28900688-28900710 GGCCTGAGTAGAACAGAAGGTGG + Intergenic
1065993384 10:31033297-31033319 GGAATAAATAGACCCAAAGGAGG + Intergenic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1067819502 10:49515638-49515660 GTTCGAAACAGAACAAAAGAGGG + Exonic
1069596588 10:69675924-69675946 AGCTTGAATAGAACAAAAGGTGG - Intergenic
1071231756 10:83596123-83596145 GGCCTACATAGAACAAAAGGTGG + Intergenic
1072441420 10:95459514-95459536 AGTCCAAAGAGAAGAAAAGGAGG + Intronic
1073886557 10:108046558-108046580 GGCCTAAATAGGACAAAAAGTGG + Intergenic
1078735814 11:14019839-14019861 GTTCTAAATAGGAGAGAAGGAGG + Intronic
1080047869 11:27828049-27828071 GGTGAAAATAGAAGAAAATGGGG + Intergenic
1081559612 11:44201271-44201293 GGTCTAAACAGAAGAATATGGGG - Intronic
1085154964 11:74284971-74284993 GTTATAAAAAGAACCAAAGGAGG - Intronic
1085712746 11:78844635-78844657 TGTCTAAAAAAAAAAAAAGGAGG + Intronic
1085804922 11:79626781-79626803 GCCCTAAAAAGAAGAAAAGGAGG - Intergenic
1086172474 11:83851622-83851644 GGTCTCAAAAAAAAAAAAGGCGG + Intronic
1087196380 11:95308184-95308206 AGTCTGAATAGGGCAAAAGGTGG + Intergenic
1087461183 11:98450335-98450357 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1088410811 11:109532396-109532418 GGTGTAAAAAGAACCACAGGAGG - Intergenic
1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG + Intergenic
1089141015 11:116284171-116284193 TCTCTAAAAAGAAAAAAAGGGGG - Intergenic
1089164445 11:116464316-116464338 GGCCTGAATAGAACAAAAGGTGG + Intergenic
1090441102 11:126726369-126726391 CATCTAAAAAGAAAAAAAGGAGG - Intronic
1090575412 11:128096770-128096792 GGACTGAATAGAACAAAAGAGGG + Intergenic
1091179866 11:133594790-133594812 GGTCCTAATAAAACAAAAAGAGG - Intergenic
1091258892 11:134218093-134218115 GGTCTCAAAAAAAAAAAAGGGGG + Intronic
1092311169 12:7355534-7355556 GGTTTAGACAGAACAAAAGTAGG + Intronic
1092396459 12:8131507-8131529 GATCTGAATGGAACAAAAAGAGG - Intronic
1094304902 12:29007865-29007887 GGTCTGTATATAACAAAAAGTGG + Intergenic
1095370806 12:41465123-41465145 GGGATAAAAAGTACAAAAGGCGG - Intronic
1098373496 12:69785618-69785640 GGCCTGAATAGAACAAAAAAGGG - Intronic
1099485294 12:83222531-83222553 GGCCTGAATAGAACAAAAGATGG - Intergenic
1101183155 12:102242001-102242023 GGACTGAATTGAACAAGAGGAGG - Intergenic
1101550878 12:105760471-105760493 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1101927966 12:108989071-108989093 CGTCTCAAAAGAAAAAAAGGAGG - Intronic
1102442418 12:112973892-112973914 GGCCTGAATAGAACAAAAAGAGG - Intergenic
1105783434 13:23724302-23724324 GGCCTGAATGGAACAAAAGGTGG - Intergenic
1106434363 13:29710704-29710726 GGTGTAAATAGAAGAAAAGGTGG - Intergenic
1106546294 13:30733737-30733759 GGCCTGAATAGAACAAAAAGCGG + Intronic
1106734243 13:32572947-32572969 GACCTGAATAGAACAAAAGATGG + Intergenic
1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG + Intergenic
1108232332 13:48360332-48360354 GGTCAAAATACAACAAATGGAGG + Intronic
1108746010 13:53395070-53395092 AAGCTGAATAGAACAAAAGGTGG + Intergenic
1109298027 13:60558736-60558758 AGGGCAAATAGAACAAAAGGAGG - Intronic
1109548843 13:63865378-63865400 GGATTAAATACAACAAAAGAGGG + Intergenic
1109561160 13:64052384-64052406 GGTGAAAAGAGAAAAAAAGGGGG + Intergenic
1110576075 13:77056391-77056413 GAGCTTAATAGAACAAAAAGGGG + Intronic
1110613390 13:77514122-77514144 GGTGTGATTAGAACAAAAGCAGG - Intergenic
1110721876 13:78770786-78770808 TGTCTAAACAGAATAAAAAGAGG - Intergenic
1111174530 13:84577143-84577165 GGTCTAAAATGAACAAGAGTTGG + Intergenic
1112824143 13:103372607-103372629 GGCCAGAATAGAACAAAAAGCGG - Intergenic
1116101076 14:40437161-40437183 GGCCTTAATAGAAAAAAAGAAGG - Intergenic
1116530430 14:45966075-45966097 GGTCTGAACAGAACAAAAGATGG - Intergenic
1116577007 14:46587666-46587688 GGGCCAAATAGTACCAAAGGAGG + Intergenic
1116978126 14:51138545-51138567 GGCCTGAGTAGAACAAAAGGTGG - Intergenic
1117713288 14:58554897-58554919 GGTAAAAAAAGAACAAATGGAGG - Intergenic
1117774363 14:59167447-59167469 GCCCTGAATAGAATAAAAGGGGG - Intergenic
1118228861 14:63929098-63929120 GGCCTCATTAGAACAAAAGATGG - Intronic
1119802798 14:77460568-77460590 TGTCTAAAAAAAAAAAAAGGAGG - Intronic
1119941831 14:78649381-78649403 AGTCTAAAGAGGATAAAAGGGGG - Intronic
1120114784 14:80602469-80602491 TGTCTAAATAAATTAAAAGGAGG + Intronic
1120484349 14:85092266-85092288 GGTCTGAATGGAAAAAAAGTTGG + Intergenic
1120562262 14:86009837-86009859 GGCCTGACTAGAGCAAAAGGTGG - Intergenic
1124024156 15:25949207-25949229 GGCTTGAGTAGAACAAAAGGAGG + Intergenic
1126905114 15:53356576-53356598 GGGCTGAATACAGCAAAAGGTGG + Intergenic
1127094648 15:55500390-55500412 AGTAGGAATAGAACAAAAGGGGG - Intronic
1127901164 15:63341921-63341943 GGTATGCATGGAACAAAAGGTGG + Intronic
1128606290 15:69038881-69038903 GGTCTATAGTGAAAAAAAGGGGG - Exonic
1130027641 15:80283528-80283550 GGCCTGAATAGAACAAAAGACGG + Intergenic
1131563555 15:93464914-93464936 GGCATGAATAGAACAAAAGGTGG - Intergenic
1132293166 15:100717350-100717372 GGTTTAAATAAAAATAAAGGTGG + Intergenic
1132609697 16:809311-809333 GGCCCAGATAGAACAAAAAGGGG - Intronic
1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG + Intergenic
1134468767 16:14503021-14503043 GGTTTAAATAAAACATAAGACGG + Intronic
1135912775 16:26576733-26576755 GGTCTGAATAGAGCAAAAAGTGG - Intergenic
1136925913 16:34374024-34374046 ATTTTAAATAGAACAAAATGGGG - Intergenic
1136978661 16:35037782-35037804 ATTTTAAATAGAACAAAATGGGG + Intergenic
1138032477 16:53570775-53570797 GACCTGAATAGAACAAAAGGTGG + Intergenic
1138501637 16:57448709-57448731 TGTATAAATACAACAAAAGGGGG - Intronic
1141032161 16:80598506-80598528 GGTCAATGAAGAACAAAAGGAGG + Exonic
1143340419 17:6206744-6206766 GGTGTAATTGGAACATAAGGTGG - Intergenic
1146793823 17:35767669-35767691 GGTCAAAAGAGGACAAAAGAGGG - Intronic
1149917452 17:60623774-60623796 GGACTAAATAGAACCAAAAGAGG - Intronic
1150942000 17:69702959-69702981 GTTCTGAATAGAATAAAAAGTGG - Intergenic
1152143879 17:78555819-78555841 GGCCTGAATAGCACAAAAGGCGG + Intronic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1153279299 18:3399128-3399150 AGCCTGAAAAGAACAAAAGGTGG + Intergenic
1154079171 18:11237314-11237336 ACTTTAAATAGCACAAAAGGCGG - Intergenic
1155260463 18:24037469-24037491 GGGATAAATAGCACAAATGGTGG - Intronic
1155815266 18:30299865-30299887 GCTTTAAATATAACAAAAGTTGG - Intergenic
1156831776 18:41500447-41500469 ATTCTTAATAAAACAAAAGGTGG - Intergenic
1157421391 18:47550512-47550534 AGCCTAAACAGAACAAAAGCAGG + Intergenic
1157801621 18:50626094-50626116 GGCCTTAATAGAACAAATGAAGG - Intronic
1158099477 18:53813442-53813464 ATTCAAAATAGAACAAAATGAGG + Intergenic
1158821009 18:61158831-61158853 GGCCTGAATAGAAGAAAAGGTGG - Intergenic
1159831938 18:73287808-73287830 GATTTCAATAGAAAAAAAGGTGG - Intergenic
1161816536 19:6502701-6502723 GGTCTAAATAGAATGAGAAGGGG - Intronic
1162880118 19:13652527-13652549 GGCCTGAGTAGAACAAAAGATGG - Intergenic
1163709643 19:18839093-18839115 CGTCTAAAAAGAAAAGAAGGGGG - Intronic
1163857851 19:19719771-19719793 GGTCTAAATACAACAAATGGTGG + Intronic
1165170657 19:33889540-33889562 GGTCTCAAAAAAAAAAAAGGCGG - Intergenic
1166025458 19:40079736-40079758 GGTCAAGAAAGAACATAAGGAGG + Intronic
1167312124 19:48743028-48743050 TGTCTAAAAAGAAAAAAAAGAGG - Intronic
1167556424 19:50199033-50199055 AGTCTTACTAGAGCAAAAGGAGG - Intronic
1167761698 19:51453972-51453994 GGGCTATAGAGAAGAAAAGGAGG + Intronic
1168701585 19:58442943-58442965 GGGCCAAATAGAATAAAAGCTGG - Intergenic
925551317 2:5078525-5078547 TGTCTAAATAGATAAAAAAGAGG - Intergenic
925551479 2:5080177-5080199 TGTCTAAATAGATAAAAAAGAGG - Intergenic
926985080 2:18613644-18613666 GGTCTGAATAGACCAAAAAGGGG + Intergenic
928460956 2:31472127-31472149 GGCCTGAGTAGAGCAAAAGGTGG - Intergenic
928487354 2:31746127-31746149 GGTCTAGAGACAATAAAAGGTGG + Intergenic
930831957 2:55753955-55753977 GGCCTGAGTAGAATAAAAGGTGG - Intergenic
931188490 2:59976739-59976761 GGAGGAAATAGAACAAAAGCAGG + Intergenic
931687003 2:64802770-64802792 AACCTAAACAGAACAAAAGGTGG - Intergenic
932444373 2:71766198-71766220 GGTCTGAATAGAATAAAAGGTGG + Intergenic
935527195 2:104184591-104184613 GGCCTAAATAGAACAAAAAGTGG + Intergenic
936438536 2:112529727-112529749 GGCATAAAAAGAACAAAAAGGGG - Exonic
938051156 2:128173114-128173136 TGTCTAAATAGAATCAAATGTGG + Intronic
939735852 2:145843878-145843900 GGCCTGAATAGAATAAAAAGTGG + Intergenic
939851179 2:147307210-147307232 GGCCAGAATAGAATAAAAGGTGG - Intergenic
941194122 2:162425042-162425064 GGCCTGAATAGAAGAAAAAGGGG + Intronic
941492982 2:166165287-166165309 GGCCTGAATAGAACAAAAGGTGG - Intergenic
942745677 2:179229285-179229307 AGCCCAAACAGAACAAAAGGAGG + Intronic
943086140 2:183313684-183313706 GGCCTGAATAGACAAAAAGGTGG - Intergenic
943330070 2:186548593-186548615 AGTCTGAATAGAACAAAATGTGG + Intergenic
943579833 2:189672294-189672316 GGAGTAAATAGACAAAAAGGTGG - Intergenic
947082191 2:226411070-226411092 GGCCTAAATAGAACAAAAAGAGG - Intergenic
947405743 2:229774259-229774281 GGTCTAAAAAACACAAATGGGGG + Exonic
948704936 2:239784190-239784212 AGCCTGAATAGAACAAAAGGTGG - Intronic
1170087501 20:12551049-12551071 TGTATTAAAAGAACAAAAGGTGG + Intergenic
1170813026 20:19689621-19689643 GGTCAAAATAGAGCAACAAGGGG - Intronic
1171106831 20:22441520-22441542 GGGCTAAATAGAAGAACAGATGG + Intergenic
1172234636 20:33362677-33362699 TGTAAAAATAGTACAAAAGGAGG + Intronic
1172760711 20:37319300-37319322 GGCCTGAACAGAACAAAAAGAGG - Intergenic
1174877827 20:54246726-54246748 GCTCTGAATAGAACAAAAGGTGG - Intergenic
1174911476 20:54612561-54612583 GGCCAGAATAGAACAAAAGGAGG + Intronic
1174931384 20:54819017-54819039 GGCCTGAATGGAACAAAAGGCGG + Intergenic
1174931429 20:54819622-54819644 GGCCTGAATGGAACAAAAGGAGG - Intergenic
1175709164 20:61205561-61205583 TGTCTAACCAGAATAAAAGGAGG - Intergenic
1176410434 21:6446895-6446917 GGCCTGAATAGAACCAAAGGTGG + Intergenic
1176673846 21:9758842-9758864 TGACTAAATAGAATAAAAAGGGG + Intergenic
1177682081 21:24384946-24384968 GGCCTGAATAGAACAAATGGTGG + Intergenic
1177770971 21:25515142-25515164 GGCCTGAATAGAACACAAAGTGG - Intergenic
1177774012 21:25548100-25548122 AGCCTAGATAGAACAAAAAGTGG - Intergenic
1177865770 21:26511783-26511805 TGTCTTAAAAGAATAAAAGGAGG - Intronic
1177897237 21:26868137-26868159 GGCTTAAATAGAACAAAAGGTGG - Intergenic
1177957895 21:27623591-27623613 GGCCTGAATAAAGCAAAAGGTGG + Intergenic
1178207294 21:30484990-30485012 GACCTAAATAGAACTAAATGGGG + Intronic
1178390775 21:32196224-32196246 GGACTGAATGGAAAAAAAGGCGG + Intergenic
1179685927 21:43055217-43055239 GGCCTGAATAGAACCAAAGGTGG + Intronic
1180916769 22:19494296-19494318 GGGACAAAGAGAACAAAAGGTGG - Intronic
1184200902 22:42968708-42968730 GGCCTAAAAAGAACAAAAACAGG + Intronic
949133745 3:536996-537018 GGCTTGAATAAAACAAAAGGTGG - Intergenic
949585332 3:5431488-5431510 GGCCTGAATAGAACAAAAGGTGG + Intergenic
949652084 3:6171381-6171403 AGTCTGACTAGAATAAAAGGTGG + Intergenic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
953166244 3:40467496-40467518 GGTTCAAATAGAACAAAATGGGG - Intergenic
953938837 3:47072345-47072367 GATCTCTATATAACAAAAGGTGG - Intronic
955152450 3:56381745-56381767 GGTGGAAAAAGAAAAAAAGGGGG + Intronic
956885096 3:73551275-73551297 GGTATAGAAAGAAGAAAAGGAGG + Intronic
957262818 3:77922556-77922578 GGTATTAATAGAAGAAAAGAAGG + Intergenic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
957693822 3:83607314-83607336 GGTCAAAAGAGAACAGAAGAGGG + Intergenic
958043050 3:88248970-88248992 GGCCTGAATAGAACAAAAAATGG + Intergenic
958185294 3:90111920-90111942 GGCCTGAATAGAACAAAAAGTGG + Intergenic
958832100 3:99101652-99101674 GGCCTGAAGAGAACAAAAAGTGG - Intergenic
959221686 3:103529515-103529537 GGCCCGAATAGAACAAAAAGGGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960619872 3:119627536-119627558 GGACTAAAAAGAACACAAAGAGG + Intronic
962981391 3:140493630-140493652 GGTCATAATATAACAGAAGGGGG + Intronic
963148734 3:142021627-142021649 GTTCTAGATACAAGAAAAGGAGG - Intronic
964388436 3:156173867-156173889 GACCTGAATAGAACAAAAGATGG + Intronic
965485617 3:169274557-169274579 ATGCTAAATAGAACTAAAGGGGG + Intronic
966189324 3:177257886-177257908 GGTATAAATAGAAAACAAGAAGG - Intergenic
966552767 3:181223522-181223544 GGCCCAGATAGAACAAAAGGCGG + Intergenic
969090781 4:4692492-4692514 GGCTCAAATAGAACAAAAGGTGG - Intergenic
971737778 4:30478983-30479005 GGTATAAATAAAACAAATGTTGG + Intergenic
972005916 4:34105667-34105689 GTCCAAAATAGAACAAAAGGTGG - Intergenic
972357239 4:38291619-38291641 TGTCAAAATAGAAAAAAAAGAGG - Intergenic
972767939 4:42168991-42169013 GGTCTCAATAGAATAAAAATGGG - Intergenic
973938302 4:55874979-55875001 GGTCTCTGTAGAACCAAAGGGGG - Intronic
973996431 4:56463954-56463976 GGCCTGAATAGAACAAAAAAGGG + Intergenic
974104531 4:57454566-57454588 GAACTGAATAGAATAAAAGGTGG + Intergenic
974661622 4:64897722-64897744 GGTTTCAATAGCACAACAGGAGG + Intergenic
974847768 4:67371694-67371716 GGCTTGAGTAGAACAAAAGGTGG - Intergenic
976078870 4:81331894-81331916 GGGGTCAATAGAAGAAAAGGAGG - Intergenic
978429321 4:108617183-108617205 GGTCTGAATAGAAAAACATGCGG + Intergenic
978613179 4:110566784-110566806 GGCCAAAATAGAACAGAAGATGG - Intergenic
979856518 4:125639486-125639508 TGTCTGTATAAAACAAAAGGAGG + Intergenic
980125584 4:128770878-128770900 GCTGTAAATAAAACAAACGGGGG - Intergenic
980502225 4:133671550-133671572 GTCGTAAATAGAACAAAAAGAGG + Intergenic
981866426 4:149425581-149425603 GATTTAAATAGAAAAAAAGGTGG - Intergenic
982715769 4:158806036-158806058 GGTTTAAAAAAAAAAAAAGGTGG - Intronic
983413828 4:167430132-167430154 GGTCTAAATCAAATAAAAAGAGG + Intergenic
985256981 4:188080072-188080094 GCCCTAATTAGAACAAAAGGTGG - Intergenic
985763474 5:1764087-1764109 GGTCTTGATAGAAGAAAATGGGG + Intergenic
985805018 5:2037246-2037268 TGTGTAAATACAAAAAAAGGAGG - Intergenic
986428223 5:7655539-7655561 GGCCAGAAGAGAACAAAAGGTGG - Intronic
987162825 5:15162144-15162166 GTTCTGAATGGAACAAAATGGGG + Intergenic
987464443 5:18254920-18254942 GGTGGAAAGAGAACAGAAGGAGG - Intergenic
988170449 5:27648500-27648522 GGTCTCAAAAAAAAAAAAGGTGG - Intergenic
988864684 5:35322039-35322061 GTTCTAAATTAAACACAAGGAGG + Intergenic
988879229 5:35482394-35482416 GGCCTAAATAGAACAAGAATTGG + Intergenic
990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG + Intronic
991300482 5:65124753-65124775 GGTATAACTGGAAAAAAAGGGGG - Intergenic
991332732 5:65510170-65510192 AGTCAAAATAGGACAAAAGCTGG + Intergenic
991658637 5:68928268-68928290 TTTCTAAATAGAAAAAAAGCTGG + Intergenic
992834447 5:80626198-80626220 GGTGTACAAAGAACAACAGGAGG + Intergenic
993392258 5:87334336-87334358 GGTCTGAACAGAACAAAAAATGG - Intronic
994262144 5:97672357-97672379 GGCCCAAATAGAACAAAATGTGG + Intergenic
995198943 5:109404945-109404967 AGTCTAAGAAGAAGAAAAGGTGG + Intronic
995275451 5:110272879-110272901 GGTCTAAAAACAACAACAGCTGG + Intergenic
995296074 5:110523949-110523971 GGTTTAAAAAAAAAAAAAGGGGG + Intronic
995437694 5:112156496-112156518 GGCCTCAATAGAACAAAAAACGG - Intronic
996175132 5:120347166-120347188 GGCCTGAATAGAACAAAAAGAGG + Intergenic
998197106 5:140083659-140083681 GGTTAAAAAAGAAAAAAAGGAGG + Intergenic
998359057 5:141568746-141568768 GGTATCAATAAAACATAAGGGGG + Intronic
998538993 5:142961486-142961508 TGTCTCAAAAAAACAAAAGGGGG + Intronic
998972046 5:147603916-147603938 GGTTTAAAAAAAACAAAAAGGGG - Intronic
1000855957 5:166398485-166398507 TGTCTAAATTGAAGAAAACGTGG - Intergenic
1001898838 5:175405418-175405440 GGCCAAAATAGAACAAAAAGGGG - Intergenic
1002306207 5:178285518-178285540 AGTCTCAATAGAAGAAAAGATGG - Intronic
1004691966 6:17999894-17999916 GGTCTCAATAGAACAAAAAAAGG - Intergenic
1004735961 6:18406701-18406723 GGCCTAAAAAGAACAAAAGGAGG - Intronic
1005723774 6:28629015-28629037 GGTCTGAATAGAACAGAAGGAGG - Intergenic
1006015505 6:31077582-31077604 GGACTGACAAGAACAAAAGGCGG + Intergenic
1006391195 6:33759867-33759889 CGTCTAAAAAAAAAAAAAGGAGG + Intergenic
1008186703 6:48401305-48401327 GTTCTGAAAAGAAAAAAAGGTGG + Intergenic
1011176789 6:84570770-84570792 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1011907446 6:92389292-92389314 GGCCTAAATAGAAGAGAAAGTGG - Intergenic
1012747833 6:103117228-103117250 GGCCCAAACAGAACAAGAGGTGG + Intergenic
1013618580 6:111867704-111867726 GGTCTAAATGGAAGGAAAGGAGG - Intronic
1013651253 6:112197165-112197187 GGTCTAAATACAATACAATGTGG + Intronic
1014400886 6:120988225-120988247 GGCCTGAATAGAATAAAAGGTGG - Intergenic
1014866053 6:126531857-126531879 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1015272246 6:131348980-131349002 AGTCTAAATAGAAGAGAAGCAGG + Intergenic
1016530983 6:145057931-145057953 GGAGTAAATAGAACAGAAGCTGG - Intergenic
1017250867 6:152278250-152278272 GGTGGAAATAGAGCAGAAGGTGG - Exonic
1017447326 6:154518623-154518645 GGCCCAAATAAAACCAAAGGCGG + Intergenic
1017657373 6:156642765-156642787 GGCCTGAATAGAGCAAAAGGCGG - Intergenic
1018582815 6:165322254-165322276 GGCCTTGATAGAACAAAAGGAGG + Intergenic
1019534267 7:1520368-1520390 GGTCCAACTGGAACAGAAGGTGG + Intergenic
1019939217 7:4276088-4276110 CCTCTAGAAAGAACAAAAGGAGG + Intergenic
1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG + Intergenic
1024412520 7:49061921-49061943 TGCCTGAATAGAGCAAAAGGAGG - Intergenic
1024814523 7:53253325-53253347 GGCCTAAATAGAACAAAATGTGG - Intergenic
1026219896 7:68386109-68386131 GTGCTAAATAGAACACAAAGGGG - Intergenic
1026291774 7:69013447-69013469 GGCCTAAATAGAATAAAATGTGG - Intergenic
1027135209 7:75618975-75618997 TGCAGAAATAGAACAAAAGGTGG - Intronic
1027434056 7:78145592-78145614 GGCCAAAAGAGAACAACAGGGGG - Intronic
1027681550 7:81228939-81228961 GGTGGGAATAGAACAAAAAGGGG - Intergenic
1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG + Intronic
1028836174 7:95377339-95377361 GGGCAAATCAGAACAAAAGGCGG + Intronic
1030766243 7:113413337-113413359 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1031154372 7:118092183-118092205 AGTCAAAAAAGAAAAAAAGGTGG - Intergenic
1031216712 7:118901807-118901829 GGAATAAATGGAAAAAAAGGAGG - Intergenic
1031626335 7:123996870-123996892 GCTTTAAAAAGAAAAAAAGGGGG + Intergenic
1032313201 7:130808043-130808065 GCTGTAAATAGAACAAAAAGAGG + Intergenic
1032862915 7:135898560-135898582 GGCCTGAATAGAACAAATGGTGG - Intergenic
1034105300 7:148484568-148484590 GGCCTAACTAGAACAAAAAGCGG - Intergenic
1035521924 8:281759-281781 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1036277860 8:7371647-7371669 GGTTAAAATAAAACAAGAGGGGG + Intronic
1036343663 8:7940245-7940267 GGTTAAAATAAAACAAGAGGGGG - Intronic
1037384725 8:18326240-18326262 GGCCTGAATAGAACAAAAGGTGG - Intergenic
1038625129 8:29185085-29185107 AGTCAACATGGAACAAAAGGAGG - Intronic
1039384867 8:37126513-37126535 GGTCTGAATAGATCAAAAAGGGG - Intergenic
1039575500 8:38620507-38620529 GGCCTGAATAGAAGAAAAGGTGG + Intergenic
1040509227 8:48078800-48078822 GGCCTGAACAGAACAAAAAGTGG - Intergenic
1041224216 8:55682791-55682813 GGCCTGAATAGGACAAAAGGTGG - Intergenic
1041262780 8:56036292-56036314 GGCCTGAACAGAGCAAAAGGTGG + Intergenic
1041354619 8:56987416-56987438 AGTGTGAATAGAACAAAAGGAGG + Intronic
1042045592 8:64647722-64647744 GGCCTGAATAGAATAAAATGTGG - Intronic
1042320387 8:67469303-67469325 GCCCTGAATAGAACAAAAAGAGG + Intronic
1042472448 8:69206786-69206808 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1043706837 8:83360743-83360765 AGATTAAATAGAACAAAAGGTGG + Intergenic
1044083991 8:87921151-87921173 GGCCCAGATAGAACAAAAAGAGG + Intergenic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1045813345 8:106250488-106250510 GGCCTGAATAGAACAAAAAGTGG - Intergenic
1047875623 8:129134261-129134283 GGTTTAAAGAGAACAAAACATGG + Intergenic
1048175478 8:132148692-132148714 GGCCCAAATAAATCAAAAGGAGG + Intronic
1048378331 8:133842660-133842682 AGTCTAAAAAAAAAAAAAGGCGG + Intergenic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1048709976 8:137199082-137199104 GGCCCAAGTAGAACAAAAAGTGG - Intergenic
1048773056 8:137916172-137916194 TATCTAAAGAGAACAGAAGGTGG + Intergenic
1051063442 9:13072889-13072911 GGCCTGATTAAAACAAAAGGTGG - Intergenic
1051246302 9:15115493-15115515 GGTTAAAGTATAACAAAAGGAGG + Intergenic
1051280146 9:15434814-15434836 CGGATAAATAGAACAAAACGTGG - Intronic
1051856068 9:21566810-21566832 GGTCTGAAGAGTATAAAAGGAGG - Intergenic
1053342408 9:37348776-37348798 GGTGTAAATGGAAGACAAGGTGG - Intronic
1054852863 9:69866536-69866558 GGCCTGAACAGAACAAAAAGAGG - Intronic
1055161915 9:73140640-73140662 GGTATAAATGAAACAAAATGAGG + Intergenic
1057966634 9:99510438-99510460 GCTCCAAGTAGAACAAAAGCTGG + Intergenic
1059004928 9:110391899-110391921 GGACCAAATAGAACAAAACATGG + Intronic
1060307355 9:122426817-122426839 GTTAGAAAAAGAACAAAAGGGGG + Intergenic
1061336001 9:129936556-129936578 GGAGAAAAAAGAACAAAAGGTGG - Intronic
1061369481 9:130190293-130190315 GGTCCAAATCGGACAAAAGCAGG + Intronic
1185989543 X:4877863-4877885 GGACTGAATAGAACACAAAGTGG + Intergenic
1186140217 X:6563996-6564018 AGCCTGAATAGTACAAAAGGAGG - Intergenic
1186341455 X:8650377-8650399 GGGTTAAATAGAACAACAGTAGG + Intronic
1186886719 X:13921577-13921599 TGTCTAAAAAAAAAAAAAGGGGG - Intronic
1187054844 X:15732959-15732981 GGCAGAAATAGAACAGAAGGTGG + Intronic
1187506425 X:19882119-19882141 AATCTAAATAGAACCAAAGATGG + Intronic
1187535553 X:20138628-20138650 GGTTTAAAAAAAAGAAAAGGAGG + Intronic
1191041470 X:56085490-56085512 AGCCTGAATAGAACAAAAGGTGG - Intergenic
1191083143 X:56535331-56535353 AGTCTTGATACAACAAAAGGTGG + Intergenic
1193632416 X:83906355-83906377 GTCCTAAATAAAAGAAAAGGTGG - Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1194393415 X:93348631-93348653 GGCCTAAAGAGAACAAAAAATGG - Intergenic
1194649791 X:96500907-96500929 GACCTGAATAGAACAAAAGGTGG + Intergenic
1194669572 X:96714111-96714133 AGTCTAATTAGAAAAAAAAGTGG - Intronic
1194884049 X:99290534-99290556 GCTCTGAAGAGAACAAAAGAAGG - Intergenic
1196727029 X:118904976-118904998 ACTCTAAATAGAAGAAAAGAGGG - Intergenic
1196913150 X:120504962-120504984 GGCCTGAATAGAACAAGAGGTGG + Intergenic
1197945650 X:131836397-131836419 AGTGTATATAGAAGAAAAGGTGG - Intergenic
1198468039 X:136921224-136921246 AGGCTGAATAGAACAAAAGTAGG - Intergenic
1199001145 X:142637920-142637942 AGTCTAAATAGAATAAAATTTGG + Intergenic
1199493215 X:148424113-148424135 GGTCTGAATAGAACAAAAGGTGG - Intergenic
1199541872 X:148966585-148966607 TGTCATAATAGAACAAAAGCTGG + Intronic
1200320862 X:155187721-155187743 GGTCTTAAGAGATAAAAAGGAGG - Intergenic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1201687038 Y:16716455-16716477 GGACTGAATAGAACAAAAAGTGG - Intergenic