ID: 920927780

View in Genome Browser
Species Human (GRCh38)
Location 1:210358837-210358859
Sequence CAAAATGCTGAGAGTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 8, 3: 111, 4: 522}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920927774_920927780 -3 Left 920927774 1:210358817-210358839 CCCCAGAATTAATTTCCCATCAA 0: 1
1: 0
2: 1
3: 25
4: 271
Right 920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG 0: 1
1: 0
2: 8
3: 111
4: 522
920927776_920927780 -5 Left 920927776 1:210358819-210358841 CCAGAATTAATTTCCCATCAAAA 0: 1
1: 0
2: 2
3: 24
4: 315
Right 920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG 0: 1
1: 0
2: 8
3: 111
4: 522
920927773_920927780 13 Left 920927773 1:210358801-210358823 CCTCTTACTACACACACCCCAGA 0: 1
1: 0
2: 0
3: 32
4: 335
Right 920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG 0: 1
1: 0
2: 8
3: 111
4: 522
920927775_920927780 -4 Left 920927775 1:210358818-210358840 CCCAGAATTAATTTCCCATCAAA 0: 1
1: 0
2: 5
3: 26
4: 350
Right 920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG 0: 1
1: 0
2: 8
3: 111
4: 522
920927772_920927780 14 Left 920927772 1:210358800-210358822 CCCTCTTACTACACACACCCCAG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG 0: 1
1: 0
2: 8
3: 111
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920927780 Original CRISPR CAAAATGCTGAGAGTGAAAA GGG Intronic
900766527 1:4509638-4509660 CAAAAAGCAGAGAGGGCAAAAGG - Intergenic
901096557 1:6685341-6685363 AGAAAGGATGAGAGTGAAAAAGG - Intronic
901828877 1:11880089-11880111 CAGAGAGCTGAGAGTGAGAACGG + Intergenic
902097544 1:13959034-13959056 CATGATGGTGGGAGTGAAAATGG - Intergenic
903437591 1:23363098-23363120 GAAAATCCTGAAAGTGAAGAGGG - Exonic
907198036 1:52703205-52703227 CAAAATGCTGAGAGTCCCGAGGG - Intergenic
908756050 1:67469861-67469883 CAAACTGAAAAGAGTGAAAAAGG + Intergenic
908871832 1:68621657-68621679 CAAATTGCTAAGAGAAAAAAAGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909326677 1:74360176-74360198 CAAAATGCTGAGGACAAAAAAGG - Intronic
909724945 1:78823395-78823417 CCATAAGCTGAGAGTGAAGATGG - Intergenic
910727230 1:90351762-90351784 AACAATGTTGTGAGTGAAAATGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
911820363 1:102411625-102411647 CAAAATGCTGAGTGTCACACTGG - Intergenic
912171337 1:107103403-107103425 CAAAAGGCACATAGTGAAAAGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913347776 1:117825483-117825505 CAAAATGATGAGAGATAGAATGG + Intergenic
914902328 1:151717303-151717325 AAAAATGCAGAGAGGAAAAATGG + Intronic
915305667 1:154976083-154976105 TAAAATACTGAGAGGAAAAACGG + Intronic
916253879 1:162766549-162766571 AAGAATGCAGAGAGTGAAACTGG + Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917538399 1:175891065-175891087 CATGATGCTGAGAGGGAAAATGG - Intergenic
917620284 1:176788596-176788618 CAAACTGCAGTGAGTCAAAAGGG + Intronic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
918224738 1:182471283-182471305 CAAGATGATGAGATGGAAAAAGG + Intronic
918243719 1:182641511-182641533 GAAAATGCAGAGAGAAAAAAAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919601470 1:199628111-199628133 GAAAATCCTCAGACTGAAAAAGG + Intergenic
919613639 1:199777849-199777871 GTACAGGCTGAGAGTGAAAAAGG - Intergenic
919841956 1:201615814-201615836 CCAAATGCTCACAGTGGAAAGGG - Intergenic
920072079 1:203309146-203309168 CAAAATGTGGAGAGTTGAAAAGG - Exonic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921422908 1:214969200-214969222 CAGAAAGGTAAGAGTGAAAAAGG - Intergenic
921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG + Intergenic
921653778 1:217709761-217709783 CAAAATGCTGAAAATCAACATGG - Intronic
921767217 1:218985981-218986003 CAAAGTGATGGGAGTGAAAATGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922038587 1:221873880-221873902 CAAAAGGCTTACAGAGAAAAGGG - Intergenic
922639499 1:227213920-227213942 CAATTTGTTGAGAGTGAGAAAGG - Intronic
1063924514 10:10964231-10964253 CACCATGCTGAGGGTGCAAAAGG - Intergenic
1064309964 10:14203302-14203324 CCAAATGTTGAGATGGAAAATGG - Intronic
1064335144 10:14433640-14433662 CAAAATCCTGAAACTGAAAGTGG + Intronic
1064577915 10:16764521-16764543 AAAAATGCTGAGTGTGAATCTGG + Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066499449 10:35975724-35975746 AACAATACTGAGAGTGAAAGGGG - Intergenic
1066580256 10:36872736-36872758 CATAAAGCTGTGAATGAAAACGG - Intergenic
1067249020 10:44571744-44571766 CAAGATGCTGCGACTGAAAGAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1067967803 10:50933627-50933649 CAAAATGCAGAGTGTGTAAAAGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1070144409 10:73763413-73763435 CAGAGTGCCAAGAGTGAAAAAGG - Intronic
1070167530 10:73910121-73910143 TAAAATGTTAAGAGTGTAAAAGG + Exonic
1070500692 10:77070151-77070173 CAAAATGCCAAGACTGAAAGTGG - Intronic
1071137452 10:82468528-82468550 CTCAATGCTGAGATTTAAAAAGG - Intronic
1071414606 10:85429366-85429388 GAAATTGCTGATAGGGAAAAGGG - Intergenic
1071661593 10:87508248-87508270 GAAAATGTTAAGTGTGAAAAAGG - Intronic
1072312119 10:94166644-94166666 CAAAATGCTGAGTGTAACAGAGG + Intronic
1072787605 10:98294800-98294822 GGAAATGCTGAGACTGAAAGGGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073398833 10:103240470-103240492 CAAAATGCAGGAAGTGAGAAAGG + Intergenic
1073603165 10:104866711-104866733 CAAACTGTTGAGAGAAAAAATGG - Intronic
1073628992 10:105129062-105129084 CAAAATGGTGAGAGAGGAGAAGG - Intronic
1073960875 10:108926079-108926101 CAAAAGGCTGAGAAAGAAAGTGG - Intergenic
1075917135 10:126177826-126177848 CAAAAGCCTGATAGTGAAGAAGG - Intronic
1076028331 10:127135707-127135729 TAAAATGTTCAGAGTCAAAAAGG - Exonic
1076786611 10:132752779-132752801 CAAAATGCTGAGAGAAAAGGAGG - Intronic
1077279664 11:1736951-1736973 CAAAATGGAGAGATTGAAGATGG + Intronic
1078234763 11:9474054-9474076 CTAAAAGCTGAGAATTAAAATGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078501441 11:11882775-11882797 GAAAATGCTGACATTGGAAATGG - Intronic
1078854919 11:15199394-15199416 CAAAACTCTTAGAATGAAAAGGG + Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079894365 11:26100343-26100365 CAAAACGCACAAAGTGAAAAAGG + Intergenic
1080925158 11:36748546-36748568 CAAAATGCAAAGAGAGAACAAGG - Intergenic
1081100203 11:38992413-38992435 AAAATTGCTGAGAAAGAAAAAGG - Intergenic
1081254995 11:40881550-40881572 TAAACTGTTGAGACTGAAAATGG - Intronic
1082576207 11:54807322-54807344 CAAACTGCTGAGTGTAAAGAAGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082925859 11:58546512-58546534 CAGAATTCTGAGATTGAAAAAGG - Intronic
1083229495 11:61306986-61307008 GAAATTGCTGAGAGAGAAGATGG - Intronic
1084721902 11:70911760-70911782 CAAAATGACAAGAGTGAGAATGG + Intronic
1085695477 11:78701041-78701063 CAAAATGGTTAAAATGAAAAGGG + Intronic
1086938641 11:92771251-92771273 CGGAATGCTGCTAGTGAAAATGG + Intronic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087521021 11:99235990-99236012 GAAACTACTGAGAGTTAAAATGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089347710 11:117801676-117801698 CAAAATGATGAGAGAGTAAGTGG - Intronic
1089453883 11:118614588-118614610 CAAAGGGCTGAAAGTGCAAACGG + Exonic
1089464141 11:118673254-118673276 CAAAATACTGACACTGTAAAAGG - Intronic
1090801891 11:130178340-130178362 CAAAATGGTGTCAGTGAAGAGGG + Intronic
1091087228 11:132733468-132733490 CTACTTGCTGAGATTGAAAAGGG + Intronic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092870607 12:12802510-12802532 CCATAGGCTGAGAGTGACAACGG + Intronic
1094372840 12:29756867-29756889 CAAATTTCTGAAAGTGAGAATGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1094877350 12:34665532-34665554 CACAAGGCTTACAGTGAAAAAGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095561224 12:43568160-43568182 CAAACAGCTTAGAGAGAAAAGGG + Intergenic
1095635408 12:44427255-44427277 TAAAATGGTGAGATTGGAAAAGG + Intergenic
1095725184 12:45444747-45444769 CAAAATGAAGAAAGAGAAAATGG + Intergenic
1096640925 12:52993841-52993863 CAAATTCCTTAGAGTCAAAAAGG + Intergenic
1096772287 12:53943593-53943615 CAAAATGCTCAGGAAGAAAATGG - Intronic
1096979205 12:55718764-55718786 GAAAAAGCTGGGAGGGAAAAAGG - Intronic
1097469871 12:59976118-59976140 CAAAATGTTCAGTTTGAAAATGG + Intergenic
1097605741 12:61751373-61751395 AAAAATGCTGCTTGTGAAAATGG - Intronic
1097836465 12:64277837-64277859 CAAAGTGTTGAGAGGAAAAATGG + Intronic
1098221984 12:68279868-68279890 TAAAATACTTAGAGTAAAAAAGG + Intronic
1098398377 12:70046679-70046701 TAAAATGCTAAGAAAGAAAAGGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1098759537 12:74405610-74405632 GAATATGCTGAGAGAGTAAAGGG - Intergenic
1098770483 12:74546764-74546786 CAAGATACTGAAAGTGCAAAAGG + Intergenic
1098896949 12:76073940-76073962 GAAAATGCTGAGCATGATAATGG - Intronic
1099123418 12:78721312-78721334 CAAACTGCAGGGAGTTAAAAAGG + Intergenic
1099224159 12:79949242-79949264 GAAAATAATGAGAGGGAAAAGGG - Intergenic
1099248723 12:80225591-80225613 CAAAATGTTGAGAAGGAAATAGG - Intronic
1099296696 12:80837040-80837062 GAAAAGTCTGAAAGTGAAAAGGG + Intronic
1099334877 12:81342774-81342796 CAAAATTCTGACAGCAAAAATGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099972556 12:89515124-89515146 CATAATGCTCAGAGTTGAAATGG - Intronic
1100203953 12:92328243-92328265 AAAAATGATGACAGTAAAAATGG - Intergenic
1100694426 12:97076229-97076251 CAAAGTGGGGAAAGTGAAAATGG + Intergenic
1101105865 12:101439393-101439415 CAAAATGCGGGATGTGAAAATGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101339215 12:103826737-103826759 AAAAGAGGTGAGAGTGAAAAAGG - Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101675017 12:106909521-106909543 CTAAGGCCTGAGAGTGAAAAGGG + Intergenic
1101890286 12:108707963-108707985 AAAAATTCTGAGAGTAACAAGGG + Intronic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1103413693 12:120730297-120730319 GAAAATGCTGATGGTGAGAAAGG + Intronic
1103891693 12:124243780-124243802 ATAAAAGCTGAGAGTGAAAAAGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104274542 12:127313140-127313162 TAAAATGCTGAAATTCAAAAGGG + Intergenic
1104348325 12:128022647-128022669 GAAAATGGGGAGAGTGAGAAAGG - Intergenic
1105283085 13:18980972-18980994 GAAAATGCTAAGAGTAATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106868559 13:33994397-33994419 CAGAGTACTGAGAGTGAAAAAGG + Intergenic
1107654359 13:42575891-42575913 CAAAATGCTGGATGAGAAAATGG - Intronic
1109225622 13:59691086-59691108 CAAAATGCTGGGAGGTAAAAGGG + Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109438721 13:62341352-62341374 CAAAATGCTAAGATTGATCACGG - Intergenic
1109451463 13:62520066-62520088 CAAAATGCTGAGAAAGAAAATGG + Intergenic
1109656579 13:65399163-65399185 CAAAATGCAGAGAGTGTGAAAGG + Intergenic
1110256630 13:73440510-73440532 CAAGAAGCTGTGAGTGAAATGGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111780223 13:92713811-92713833 CAAAATATTGACAGAGAAAATGG + Intronic
1112755289 13:102625505-102625527 CACCATGGTGGGAGTGAAAAGGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115216691 14:31020575-31020597 CAGAATGCTGAGAGAATAAATGG - Intronic
1116363485 14:44030709-44030731 AAAATTTCTGAGAGTGAAAGGGG + Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117098962 14:52325847-52325869 CAAATTGCAGAGAGCGCAAAGGG - Intronic
1117104078 14:52381156-52381178 GAAGAGGCTGAGAGTGAACATGG - Intergenic
1117111112 14:52455791-52455813 CACAATGCTGAGTAAGAAAATGG + Intronic
1117228025 14:53683335-53683357 CATAAATTTGAGAGTGAAAAAGG - Intergenic
1117311516 14:54528882-54528904 CTAAATACTGAGAGTAAAATTGG + Intronic
1119159082 14:72438287-72438309 GAAAATGCAGAGAGAGAAGAGGG - Intronic
1120499345 14:85275201-85275223 CAAAAAGCTCAAAATGAAAAAGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120903315 14:89594885-89594907 CAAAATGCCAAGAGTAGAAAAGG - Intronic
1120958698 14:90105266-90105288 TAAAAAGCTGAGAGAAAAAAGGG - Intronic
1121167282 14:91816960-91816982 GAAAATGCAGAAAGTGAAGAGGG - Intronic
1121626173 14:95386866-95386888 CAAACTGGTTAAAGTGAAAAAGG + Intergenic
1121888448 14:97566567-97566589 CAAAATGTGGAGAGTTTAAATGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123176461 14:106423436-106423458 CATAATTCTGAGAGTGAGGAAGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124199702 15:27668490-27668512 CAAACTTAAGAGAGTGAAAATGG - Intergenic
1124825738 15:33093563-33093585 AACACTGCTGAGAATGAAAATGG - Intronic
1125051895 15:35308863-35308885 AAACAAGCTGAGAGTGAGAACGG + Intronic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126925306 15:53578775-53578797 CAAGTTGCTGAAAGAGAAAAGGG - Intronic
1127003073 15:54532837-54532859 CAAAATCCTCAGGGTGAAATTGG + Intronic
1128673008 15:69588333-69588355 CAAAATGCAAAGAGAAAAAAAGG - Intergenic
1129135816 15:73549780-73549802 CCAAATACTGGCAGTGAAAAGGG + Intronic
1130635036 15:85610513-85610535 CAAAACACTGACAGAGAAAAAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1130828870 15:87579141-87579163 GAAGATGCAGATAGTGAAAAAGG - Intergenic
1131872509 15:96776831-96776853 TAAAATGCTAAGACTGCAAATGG - Intergenic
1133194221 16:4157360-4157382 CAAAGAGCTGAGAGAGCAAAGGG + Intergenic
1133913156 16:10084289-10084311 TAAAGTGCTGAGTGGGAAAAAGG - Intronic
1133974079 16:10587944-10587966 GACACTTCTGAGAGTGAAAAGGG + Intergenic
1134312332 16:13086603-13086625 CAAAATGGTACTAGTGAAAATGG + Intronic
1134875226 16:17692254-17692276 AAAAAGGCTGAAAGAGAAAATGG - Intergenic
1135334966 16:21593532-21593554 CAAACTGCTGAGAGCGAGAAAGG - Intergenic
1136365745 16:29808374-29808396 CAAAAAGAAGAGAGAGAAAAAGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137337485 16:47564793-47564815 CAACATGCAAAGAATGAAAATGG - Intronic
1137395328 16:48113036-48113058 CAAGATGCTGAGACTAAAGATGG + Intronic
1137424889 16:48370088-48370110 CAAAGGGTTGAGAATGAAAATGG - Intronic
1138022960 16:53501564-53501586 CAAACGGCTGAAGGTGAAAAGGG + Intronic
1138247259 16:55477295-55477317 CTGAGAGCTGAGAGTGAAAATGG - Intronic
1138834810 16:60421317-60421339 CCAAAAGCAGAGTGTGAAAATGG - Intergenic
1138972155 16:62158760-62158782 CAAAATGCTGTGTGCAAAAAGGG + Intergenic
1139081941 16:63532463-63532485 CAAAATGCTTATAGTACAAAGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140254088 16:73319948-73319970 TAAAATGATGAGAGTGAACTCGG + Intergenic
1140261836 16:73387100-73387122 CAATATGCTGTGAGAGAGAATGG - Intergenic
1140993626 16:80239092-80239114 AAAAATACTGAGAATGAAAAAGG - Intergenic
1141068821 16:80934943-80934965 CACATTTCTGAGAGTGAATAAGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1143545698 17:7593877-7593899 AAAAATGCTGGGTGTGAAAAGGG - Intronic
1144310342 17:14008245-14008267 CAAAAAGCTGAGATTCAAGATGG - Intergenic
1148068565 17:44892224-44892246 CAAAATGCTGAGATTACATAGGG - Intronic
1148791554 17:50175996-50176018 CAAAATGCCAAGAGTCCAAAGGG - Intergenic
1149096913 17:52853944-52853966 CACAATGAAGAAAGTGAAAATGG - Intergenic
1149144255 17:53470820-53470842 CGAAAAGCTGAGAGTTAAGAAGG - Intergenic
1149308571 17:55372602-55372624 CAAAATACTGATAATGAATATGG + Intergenic
1151585954 17:75008611-75008633 AAAAAGGCTGAGGGAGAAAAGGG - Intergenic
1152968899 18:142518-142540 TAAAATGCTCAGCTTGAAAAGGG + Intergenic
1153800219 18:8662177-8662199 GAAAATGATGAAAATGAAAATGG + Intergenic
1155411507 18:25550449-25550471 CAATGTGAAGAGAGTGAAAATGG - Intergenic
1155596854 18:27497958-27497980 CAACATTTTGAGAGAGAAAAAGG + Intergenic
1156016605 18:32553671-32553693 CAAAATACAGAGAGTGAATGGGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156249682 18:35340566-35340588 AAAAATTCTGAGAGTGAAGTTGG - Exonic
1158367116 18:56748923-56748945 AGAAAGGCAGAGAGTGAAAAGGG - Intronic
1158776252 18:60583590-60583612 CAAATTCTAGAGAGTGAAAAAGG - Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1159704179 18:71666233-71666255 CACAGAGCTGAGAGAGAAAATGG - Intergenic
1159962211 18:74564552-74564574 CATAATTCTGAGCATGAAAAAGG - Intronic
1161985062 19:7648514-7648536 CAAAATGGTTCCAGTGAAAATGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166359786 19:42248330-42248352 CAAAATGTGGGGAGGGAAAAGGG + Exonic
1166452770 19:42916016-42916038 CATAATGCAGAGAGTGACACAGG + Intronic
1166491928 19:43267675-43267697 CATAATGCAGAGAGTGACACAGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925621129 2:5793961-5793983 AAAGATGCTGAAAGAGAAAAGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925947694 2:8880818-8880840 AAAAAGGCTGACAGTGAAATCGG + Intronic
926112246 2:10190856-10190878 TACAATGCTGAGAGTGATGATGG + Intronic
926749643 2:16188441-16188463 GACACTGCTGAGAGTGAACAGGG + Intergenic
927340038 2:21972947-21972969 CATTATGCTGAGAGAGAAATGGG + Intergenic
927797540 2:26063285-26063307 TAAAAAGCTGAAAGGGAAAAGGG - Intronic
927815505 2:26212927-26212949 GAAAGTGTAGAGAGTGAAAAGGG - Intronic
928204178 2:29272318-29272340 GAAGATGCTGAAAGAGAAAATGG - Intronic
928370682 2:30738126-30738148 GAAAATACTGAGTGGGAAAAGGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929891906 2:45925268-45925290 CAGCATGCTTAGAGAGAAAAGGG - Intronic
930775785 2:55168826-55168848 CAACATGGTAAGAGTTAAAATGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
932536120 2:72597446-72597468 TTATATGCTGAGAGGGAAAATGG + Intronic
932781599 2:74561961-74561983 CAAAAAACTGGGAGAGAAAAGGG - Intronic
932936846 2:76113452-76113474 AAAAATGCAGAGTTTGAAAAGGG - Intergenic
933026219 2:77262851-77262873 CTAAATGATGAGAGTGATAAAGG + Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937501216 2:122481200-122481222 AAAAGTACTGAGAGAGAAAATGG - Intergenic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940081575 2:149809045-149809067 CAGCATCCTGAGAGTGAAAAAGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941052881 2:160754833-160754855 CCAAATGATTAGAGTAAAAAAGG - Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942761938 2:179409951-179409973 CAAAATACTTAGAGTTAAAAAGG + Intergenic
942791066 2:179761415-179761437 CAAAATGCTGAGAAAAGAAATGG - Intronic
942838870 2:180335965-180335987 CAAATAGCTTAGAGTGATAAAGG - Intergenic
943015576 2:182506152-182506174 GAAAAGGCTAAGAATGAAAAAGG - Intronic
943294310 2:186117450-186117472 CAAAATGCTGAGTGAAGAAATGG - Intergenic
943741616 2:191416268-191416290 AAAAAAGCTGAAAGAGAAAAAGG - Intronic
943918468 2:193669618-193669640 TAAAATGCTGAGAGTTGAGATGG - Intergenic
944842460 2:203637486-203637508 CAAAATGCTGAGATGCAAGATGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946608763 2:221435545-221435567 CAAAATGAAGAGTGTTAAAAGGG + Intronic
946973070 2:225117218-225117240 AAATATGCTTAGAGAGAAAATGG + Intergenic
947075307 2:226337221-226337243 CAAAATGATGAGAAAGAAGAGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947476235 2:230449914-230449936 CAAAAAACTGAGAGAGAAAGGGG + Intronic
947870518 2:233435093-233435115 TATAGTGCTCAGAGTGAAAAGGG + Intronic
948499043 2:238377909-238377931 CAAAAAACTGACAGTCAAAATGG - Intronic
948619743 2:239227023-239227045 CAAAATGCTGGAAGTCAGAAAGG + Intronic
948659838 2:239500156-239500178 TGAAATGCTGAGGGTGAGAAGGG - Intergenic
1168782149 20:501863-501885 CAAAATCTTGAGAGGGAAACGGG + Intronic
1169683869 20:8248421-8248443 CAGAAGGCTGAGAATGGAAATGG - Intronic
1169872942 20:10266757-10266779 CAAAATGTAAAGAGTGAAAATGG + Intronic
1170259460 20:14387784-14387806 CAACATGAGGAGAGTGTAAAGGG - Intronic
1170337466 20:15286085-15286107 TAAAATGCTGAGAGAGAAAGGGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171009604 20:21501582-21501604 CAGAGTGCTGAGACTGAAGAAGG + Intergenic
1171235797 20:23523669-23523691 CAAAATGCAAAGAGGGAAGAGGG + Intergenic
1172237965 20:33390884-33390906 CTAAATTCTGAGACAGAAAAGGG + Intronic
1172995600 20:39068388-39068410 CAACAACCTGTGAGTGAAAATGG - Intergenic
1173046127 20:39514194-39514216 CAAGATGCTGAGAGAACAAAAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173546200 20:43900067-43900089 GAAAATGCTTAGATTTAAAATGG + Intergenic
1173758835 20:45542032-45542054 TGGAATGCTGAGAGTGAAACTGG + Exonic
1174927543 20:54777219-54777241 GAAAATGCAGATAGGGAAAAAGG + Intergenic
1176226944 20:64005994-64006016 CAAAATGCTGGGACTGCAGATGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177310935 21:19391767-19391789 GAAACTGCTGAGAATTAAAAGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177443038 21:21152957-21152979 CACAATACTGAGGGGGAAAATGG - Intronic
1177544128 21:22534641-22534663 CAGAATGCAGAGAGAAAAAAAGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177628973 21:23701950-23701972 CATAAACCAGAGAGTGAAAATGG - Intergenic
1177815074 21:25967701-25967723 CAGAACGCTGAGAGTTACAAGGG + Intronic
1178490243 21:33045938-33045960 AAAATTGCTGAGAGTGGAACAGG + Intergenic
1178539248 21:33435502-33435524 TAATATGCTGAGAGTTTAAAAGG - Intronic
1179068458 21:38049087-38049109 CAAAATGCAGAGGATTAAAATGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1180974626 22:19841179-19841201 CAAGATGCTGACAGGAAAAAGGG + Intronic
1182940914 22:34276367-34276389 CACAATGCAGAGAAAGAAAATGG - Intergenic
1183566468 22:38619051-38619073 GGAAATGCTGACAGTGACAATGG + Intronic
1184401912 22:44279405-44279427 GAAAATGAGGAGACTGAAAAGGG - Intronic
949096742 3:95389-95411 CAAAATCTAGAGATTGAAAAAGG - Intergenic
949228412 3:1721358-1721380 AAAAATGCCTAGAATGAAAAGGG - Intergenic
949650382 3:6151428-6151450 CCAAATGGTGAGAGGCAAAACGG - Intergenic
950148586 3:10669055-10669077 CAAAATGCTCAGAATGTAAGAGG + Intronic
950179239 3:10899550-10899572 CAAGAGGCTGAGAGGGGAAATGG - Intronic
950339866 3:12233734-12233756 CAAAATGATGAGAGGAAAAAAGG + Intergenic
950812683 3:15664640-15664662 CTAAATGATGTCAGTGAAAATGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
950972852 3:17206336-17206358 GAAGATGCTTAGAGTGAAATTGG - Intronic
951398970 3:22206658-22206680 CAATATGCTCTGAGTGACAACGG + Intronic
952043039 3:29282740-29282762 AAATATGCCGAGAGTGAACAAGG + Intronic
952430998 3:33222734-33222756 CAAAATGCTCAGAGAGTAGAGGG - Intergenic
952819844 3:37476843-37476865 CCAGATGCTGAGAATGAAAGTGG - Intronic
952853621 3:37749723-37749745 CCAAATGCTGAGACAGAAGAGGG + Intronic
952853685 3:37750213-37750235 CAAAATGCTGAAAGAGAATATGG + Intronic
953207343 3:40843059-40843081 CAAAGTGCTGGGATTTAAAAAGG - Intergenic
953234849 3:41097111-41097133 CAAACTGCTCAGAGTCAAACAGG + Intergenic
953632044 3:44626341-44626363 CTTCATGCTCAGAGTGAAAAAGG + Intronic
955862227 3:63343794-63343816 CAAAGTGCTGAGAGATAACAAGG + Intronic
955967511 3:64403932-64403954 CATCATGCTGAGAGGGAAATGGG + Intronic
955992051 3:64638474-64638496 GAACGTTCTGAGAGTGAAAATGG + Intronic
956071001 3:65451461-65451483 CAAAATGGTTAGAATCAAAAGGG + Intronic
957684703 3:83486818-83486840 GAAAATTTTGAGATTGAAAATGG + Intergenic
957790859 3:84939218-84939240 CAAAATGCTGAGTAAGAACACGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958979658 3:100706685-100706707 AAAAATCCTAAGAATGAAAACGG - Intergenic
959003983 3:100998287-100998309 GAAAAGGGTGAGATTGAAAAGGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959993139 3:112651126-112651148 CAGGATTCTGAGAGTGAAAGAGG + Intergenic
960286092 3:115830788-115830810 CAAAAGGATGAGAGGTAAAATGG - Intronic
962213361 3:133498295-133498317 CAAAATGTTGAGATTGTAATTGG - Intergenic
962240106 3:133744961-133744983 CACAATGCTAAAGGTGAAAAGGG + Intergenic
962336615 3:134537588-134537610 CAAGATGAGGAGAGTGAACATGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963149369 3:142028943-142028965 AAAAATGCTTAAAGTAAAAAGGG + Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963920550 3:150900939-150900961 CAAAATCCAGAGAGACAAAAAGG + Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964741777 3:159974240-159974262 CTAAATGCCCAGACTGAAAAGGG - Intergenic
964747826 3:160028284-160028306 CAAAATGATGACAGTTAGAAGGG - Intronic
965079697 3:164020708-164020730 GAAAAAGCTGAGAGGGCAAATGG - Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965355018 3:167663236-167663258 CCAAATGCTGTCAGAGAAAATGG + Intergenic
965583128 3:170290690-170290712 CAAAATACAAAGAGTAAAAAAGG - Intronic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
966031505 3:175354061-175354083 GAGAAGGCTGAGAGTGAAGATGG - Intronic
966429252 3:179814174-179814196 CAAAAGGCTTACAGTGAAATGGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966780226 3:183578126-183578148 GAAAATGCTTAGAGGGAAGAGGG + Intergenic
967325257 3:188232312-188232334 AAAATTGCTGAGAGTTGAAAGGG - Intronic
967585289 3:191206433-191206455 AAAAATACTGAAAGTGAAAGAGG + Intronic
967844983 3:194036005-194036027 CAAAAGGCAAAGAGAGAAAAGGG + Intergenic
968552981 4:1233533-1233555 CAAACTGCTGAGCAAGAAAAAGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970031637 4:11682528-11682550 AAAGAGGCTGAGAGTGAACATGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971791916 4:31180941-31180963 CATAATGTTGAGTGTGCAAAGGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972427612 4:38948921-38948943 TAAAATCCTGAGAGAGAAAAAGG - Intergenic
972643875 4:40949768-40949790 CAAATTGCTGAGAGTCAGAAGGG - Intronic
972731881 4:41802789-41802811 GAAAATGCTGAGACTGCAAAAGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974129781 4:57739842-57739864 GAAAATGGTGAGAGAGGAAATGG - Intergenic
974359598 4:60859845-60859867 CAAAATTCTGAGTAAGAAAATGG - Intergenic
974483218 4:62472717-62472739 CAAAATATTGGGAATGAAAAAGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974817226 4:67020932-67020954 CAACCTGCTGAGTGTGAACATGG + Intergenic
975034910 4:69667984-69668006 CAAAGTACAGAGACTGAAAATGG - Intergenic
975366623 4:73536757-73536779 CAAAGTGCTGGGATTGAGAATGG + Intergenic
975683692 4:76899048-76899070 CAACATGTGGAGAGAGAAAAAGG - Intergenic
976341271 4:83947701-83947723 CAAAGAGCTGAGAGTGGGAAGGG + Intergenic
976483964 4:85578438-85578460 GAAAATTATGAGTGTGAAAATGG - Intronic
976662038 4:87549831-87549853 CAAAAGGCTGAGAAAGGAAAAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977711359 4:100129619-100129641 CGAAATGCTGAGATTCAACAAGG + Intergenic
977800883 4:101229752-101229774 CACAATGGAGAGGGTGAAAAGGG + Intronic
978551333 4:109930484-109930506 CAAGATGAAGAGAGTGCAAAGGG - Intronic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
979102583 4:116639361-116639383 CCAGATGCTGACAGAGAAAATGG - Intergenic
979341236 4:119526495-119526517 CAAAGTGCTGACAGGGTAAATGG - Intronic
979902704 4:126243333-126243355 CAAAATGCTGTGACAGGAAATGG - Intergenic
980240887 4:130173454-130173476 CAAAATGATGTCAGTGAACATGG - Intergenic
980569400 4:134594166-134594188 CAATATGATGAGAGTAAAATTGG + Intergenic
980649842 4:135697882-135697904 TAAAATTCTGAGACTGAAACAGG - Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982184907 4:152786078-152786100 CAAAAAGCTGAGAGAGAACATGG - Intronic
982246307 4:153355411-153355433 AAAAATACTAAGAGTGAAATTGG + Intronic
982949508 4:161672351-161672373 CAAAGTGCTGAGAGTCAACAAGG + Intronic
982992524 4:162296532-162296554 AGAAATGCTGAGAATTAAAAAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983603486 4:169557571-169557593 CACAATAATGAGAGTAAAAAAGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984106131 4:175548792-175548814 CAAATTACTGAGAGAGAAACTGG - Intergenic
984351971 4:178606466-178606488 CGAAATGCTGGGAGTCAGAAAGG + Intergenic
984923630 4:184787402-184787424 TAACATGCTGGGAGGGAAAAGGG + Intronic
985270574 4:188190813-188190835 CAAAATTCTGAAAGGAAAAAAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
985535210 5:460824-460846 CAAAAAGCTGAGGGTGATCAAGG - Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987748098 5:22003963-22003985 CAAAGTGCTGAGACAGAAATGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988264529 5:28930209-28930231 AAAAATGATGAAAGTGAAGATGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988719057 5:33858348-33858370 CAAAATGCTTACAGTAGAAAAGG + Intronic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988932687 5:36052471-36052493 CAAGAGGCAAAGAGTGAAAATGG - Intronic
989184228 5:38607458-38607480 CAGAAGGCTGGGAGTGAAGATGG - Intronic
989436837 5:41423759-41423781 AAAAATGATGAGAGCAAAAATGG - Intronic
989536165 5:42565960-42565982 CAAAACACTGAGGGTGGAAATGG - Intronic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989841289 5:46074694-46074716 CAAAAAGCTTATGGTGAAAAAGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990950178 5:61290977-61290999 GACAATTCTGAGAATGAAAAAGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992504060 5:77368089-77368111 CTAAATGCTGCTACTGAAAATGG - Intronic
992715921 5:79511330-79511352 TAAACTGCTTAGAGTGAAAAAGG + Intronic
992833827 5:80621023-80621045 CAACATGTAGGGAGTGAAAATGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993539419 5:89130113-89130135 CAAAATGTTTGGAGAGAAAAAGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994305509 5:98199235-98199257 TAAAAGCCTAAGAGTGAAAAAGG + Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995135451 5:108675234-108675256 AAGAATGCTGACAGTGAAAGAGG + Intergenic
995180614 5:109227185-109227207 GAAAATACTGACAGTGAAAGGGG + Intergenic
996035811 5:118757528-118757550 GACAATGGTGAGAGTGAATACGG - Intergenic
996639195 5:125731331-125731353 AAAAATGCTGAAAATGCAAAAGG + Intergenic
996662459 5:126020569-126020591 CAAAATGCTGAGATTACAATAGG - Intergenic
997185652 5:131879347-131879369 GAAAATGTGGAGAGTGGAAATGG - Intronic
997460724 5:134050513-134050535 CAAAATACTGAGTGTGAAATAGG + Intergenic
998034850 5:138906390-138906412 CAAAGTGCTGATAGGGTAAATGG - Intronic
998226752 5:140333077-140333099 CAAAAGGCTGAGAAGGAACAGGG - Exonic
998926392 5:147130718-147130740 CCAAGTGCTGAGTTTGAAAATGG + Intergenic
1000073141 5:157759881-157759903 CAAAATACTGAGAGTAAAGGAGG - Exonic
1000239782 5:159398724-159398746 CATAATGCTGTGAATGTAAATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002060522 5:176623124-176623146 CAAAATGCTGGGAGTGGTAACGG - Intronic
1003331442 6:5132539-5132561 CAAAAGGCTGAGAGTGAAAGTGG + Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004187968 6:13437912-13437934 TAAAATGCTGAGGGAGAAAATGG + Intronic
1004416801 6:15432165-15432187 CAAAGTGCTGGGATTGCAAACGG - Intronic
1004451405 6:15751148-15751170 CAAAATGTTGAAAATGACAAAGG - Intergenic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1006064330 6:31452536-31452558 CAAAATGCTGAGATTGCAGGTGG + Intergenic
1006130314 6:31865120-31865142 GGCAATGCTGAGAGTGAAATTGG + Intronic
1006267859 6:32940386-32940408 CAAATTATTGAGAGAGAAAAAGG + Intronic
1007527836 6:42512188-42512210 CAGAATGCTGAGTGTGTCAATGG - Intergenic
1008267613 6:49449681-49449703 CAAAAAGCACAGAGAGAAAATGG + Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009711019 6:67320797-67320819 CAAAAGGCAGAGAGTAAAACAGG - Intergenic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1010387387 6:75297400-75297422 CAAAAGGCTGAGGGAAAAAATGG - Intronic
1010415250 6:75604368-75604390 CAAAATGCTGTGTGTGATTAAGG - Intronic
1010493125 6:76498573-76498595 GAAAATTTTGAGAGTAAAAAGGG - Intergenic
1010567836 6:77439170-77439192 TAGAATCCTGAAAGTGAAAAAGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010956685 6:82098318-82098340 TAAAATGTTAAGAGTAAAAAAGG - Intergenic
1011312683 6:85997776-85997798 CAAAGTGCTGAAAGTGTATATGG + Intergenic
1011551928 6:88537988-88538010 CTAAGTGCTGAGACTAAAAAAGG - Intergenic
1011907730 6:92392732-92392754 AAAAATGGTGACAGTGAAACAGG - Intergenic
1012051499 6:94350983-94351005 CTAAGTGATGGGAGTGAAAAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012277410 6:97291122-97291144 AAAAATACAGAGTGTGAAAAAGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012860036 6:104548398-104548420 CAAAATGGTGTGATTGGAAAAGG - Intergenic
1013190188 6:107796267-107796289 TACATTGCTGGGAGTGAAAATGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014090694 6:117400785-117400807 CAATATGCTGAAAGTGAATGTGG - Intronic
1014662006 6:124184236-124184258 AGAAAGGCTGATAGTGAAAAAGG - Intronic
1014714082 6:124843462-124843484 CCATTTGCTGAGAGTGAGAAAGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015921807 6:138274106-138274128 TCAGATGCTGAAAGTGAAAAAGG - Intronic
1016858536 6:148695722-148695744 AAACCTGCTGAGAGTGAAAGGGG + Intergenic
1017023846 6:150164328-150164350 CACCATTCAGAGAGTGAAAAAGG - Intronic
1017165902 6:151408231-151408253 CAAAATGCTGAGATTACAGATGG - Intronic
1017862485 6:158411973-158411995 CAAAATGCTGGGAGTAGACAAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020484716 7:8706895-8706917 CAGAATGGTGAGAGTGAGAAGGG + Intronic
1020676782 7:11193042-11193064 CAAAAAGCGGTGAGTGAAATGGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021424050 7:20478835-20478857 CCAAATGGTAAGAATGAAAAAGG - Intergenic
1022460936 7:30605986-30606008 GAAAATGCGGGGAGGGAAAAGGG - Intronic
1022616891 7:31940807-31940829 CAGGATGCTCAGAGTGAAACTGG - Intronic
1024203519 7:47131148-47131170 CACTATGCTGAGAGTAAAAAAGG - Intergenic
1026339372 7:69422166-69422188 CAAAATAGTGAGAGAGAAACAGG + Intergenic
1026796620 7:73369872-73369894 GAAAATGCTAACAGTGAGAAGGG - Intergenic
1027346780 7:77268430-77268452 CAGAAGGCTGAGAAAGAAAAAGG - Intronic
1027934037 7:84579621-84579643 CAATATGAAGAGAGAGAAAAAGG + Intergenic
1027981198 7:85224906-85224928 CAAACTGCTCAGAATGAAACTGG - Intergenic
1028166269 7:87541324-87541346 CAAAATGAATATAGTGAAAATGG + Intronic
1028300015 7:89187047-89187069 TAAAATGCTGAGAGTAAATTTGG - Intronic
1029590095 7:101501588-101501610 CAACAGGCAGAGAGTGACAAGGG - Intronic
1030367468 7:108661718-108661740 CAAAATGGGAAGAGTGATAAAGG + Intergenic
1030813869 7:114009791-114009813 TAAAATGCAGAGGGAGAAAAGGG + Intronic
1031212055 7:118841701-118841723 CAACATGCAGAGAATGAAATTGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032302952 7:130706657-130706679 CATAATGATGAGAGTATAAATGG - Intergenic
1032676966 7:134139671-134139693 ATAACTGCTGAGAGAGAAAAAGG + Intronic
1033317412 7:140309127-140309149 CAAACTGCTGAGTGGGAAATGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036289489 8:7474886-7474908 AAAAAGGCTGAGATTGAAGAAGG + Intronic
1036331985 8:7836645-7836667 AAAAAGGCTGAGATTGAAGAAGG - Intronic
1036579500 8:10060738-10060760 CAAAATTTAGAGAGTGAAATCGG + Intronic
1036606835 8:10314340-10314362 CAGACTGCTGAGAGAAAAAATGG + Intronic
1037431805 8:18821009-18821031 CCAAATGCTGAGATTATAAAAGG + Intronic
1037627089 8:20617802-20617824 GTACATGCTCAGAGTGAAAAGGG - Intergenic
1037708617 8:21337197-21337219 CAAAAAGCAGAAAGAGAAAAAGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039917927 8:41873493-41873515 CAAGAAACTGAGACTGAAAAGGG + Intronic
1040395226 8:46992423-46992445 CAGAATCCTGAGAGTTAAATTGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042602741 8:70514010-70514032 CAAAATGATGAAAGGGAAAGAGG - Intergenic
1042695837 8:71554574-71554596 AAAAATGCCGAGGGGGAAAAAGG - Intronic
1043055899 8:75437943-75437965 TAAAATGCTATGAGTGAAATAGG + Intronic
1043315147 8:78911286-78911308 CAAAATGTTAATAGTGAACATGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043766962 8:84147789-84147811 CAAAATGTTGAGCTTAAAAATGG - Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044670483 8:94675460-94675482 CAAAATGCTAAAAGATAAAAAGG - Intronic
1044910280 8:97050796-97050818 GAAACTTTTGAGAGTGAAAAGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046515895 8:115260087-115260109 CTAAATTCTGAGAGAGGAAATGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048532869 8:135266144-135266166 GTAAAGGCTGAGAGTGAATATGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050104769 9:2154142-2154164 CAAAATGCAGAGAGTAAGAGTGG + Intronic
1050549264 9:6735171-6735193 CAAACTGCTTAGTGTGAAATTGG + Intronic
1050589641 9:7148610-7148632 CCAAATGGTGGGAGTGAAATGGG - Intergenic
1050616114 9:7403269-7403291 TGGAATGCTGAGAGAGAAAAGGG + Intergenic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052324709 9:27205258-27205280 AACAATTTTGAGAGTGAAAAGGG + Intronic
1052503137 9:29318045-29318067 GAAAATGCTGAGGGTGCTAATGG + Intergenic
1052777349 9:32745645-32745667 CAAAATTCAGAAAGTGAAAAAGG + Intergenic
1053027543 9:34742406-34742428 GGAAATGCTGAGAGTGAGCAAGG - Intergenic
1053178191 9:35944717-35944739 CAAAGTGCTGCCAGAGAAAAGGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055825966 9:80325143-80325165 AAAAATGCTGAGGGTGAATGGGG - Intergenic
1057239748 9:93398558-93398580 GAAAATGTTAACAGTGAAAAGGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057579141 9:96270464-96270486 AAATATGCTGAGAGTGCAGATGG + Intronic
1058433097 9:104936567-104936589 CAAAATGCTGAAAGAGAAAGAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058756621 9:108088663-108088685 CAAGATGCTGATGCTGAAAATGG - Intergenic
1059202183 9:112428432-112428454 GAAAAAGATGAGAGTGAAAAAGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059937903 9:119330172-119330194 CAAAAGGCAGAGAAAGAAAATGG - Intronic
1060272567 9:122157152-122157174 GAAAATGCAGAGAGTCAAAAAGG - Intronic
1060746798 9:126141563-126141585 CAAAAAGCAGAGTATGAAAAAGG - Intergenic
1060880591 9:127115427-127115449 GACAATATTGAGAGTGAAAAGGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186628416 X:11320489-11320511 CAAAAGGCGGACATTGAAAAGGG + Intronic
1186848906 X:13560143-13560165 CAAAAAGCTGGGAGGTAAAATGG + Intergenic
1187981898 X:24766232-24766254 CAAAATGATGAGTGCCAAAATGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189076890 X:37925517-37925539 TAAAATGCTGGCAGAGAAAAAGG - Intronic
1189174051 X:38936249-38936271 GAACATTCTGAGAGTGAAAGGGG + Intergenic
1189329656 X:40135698-40135720 CCCAATGCTGAGAGACAAAAAGG - Intronic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191267778 X:58418666-58418688 CAAAATGCCTAGAGTGAAAAAGG - Intergenic
1192217928 X:69177008-69177030 CAGAATGTTGAGAGAGACAAAGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193568759 X:83114609-83114631 GAAAATGGAGAGAGTGAGAAAGG - Intergenic
1193687500 X:84595605-84595627 CAGACTGCTGAGAGTGAGAGAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194178024 X:90676148-90676170 CAAAATGATTAAAGTGAATATGG + Intergenic
1195476980 X:105298296-105298318 TAAAATGGTGACAGTGAAGATGG + Intronic
1196362799 X:114886004-114886026 CAAAATGCATGAAGTGAAAATGG - Intronic
1196635142 X:117993664-117993686 CAAGTTACTGAGAGAGAAAAAGG + Intronic
1196677258 X:118432694-118432716 CAAAATGCTGAGAGAACAGATGG + Intronic
1196803480 X:119564168-119564190 TAAAAGTCTGAGAGAGAAAAGGG + Intronic
1197006671 X:121510657-121510679 GAAAATTCTAAGAGTTAAAAAGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197630126 X:128848765-128848787 CAATATGCTGAGAAAGCAAAGGG - Intergenic
1197643910 X:128996722-128996744 CAAAGGGTGGAGAGTGAAAATGG - Intergenic
1198450368 X:136761780-136761802 CATAGTACTGAGAGAGAAAATGG + Intronic
1200357272 X:155565169-155565191 CAATATGCTGTGAGAGGAAAGGG + Intronic
1200524691 Y:4258305-4258327 CAAAATGATTAAAGTGAATATGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1202277527 Y:23139650-23139672 CAAAAACCTGAGAGAGAAAAAGG + Intronic
1202279499 Y:23166200-23166222 CAAAAACCTGAGAGAGAAAAAGG + Intronic
1202280227 Y:23177044-23177066 CAAAAACCTGACAGAGAAAAAGG + Intronic
1202280956 Y:23187891-23187913 CAAAAACCTGACAGAGAAAAAGG + Intronic
1202284933 Y:23230631-23230653 CAAAAACCTGAGAGAGAAAAAGG - Intronic
1202288501 Y:23281038-23281060 CAAAAACCTGAGAGAGAAAAAGG - Intronic
1202430519 Y:24773373-24773395 CAAAAACCTGAGAGAGAAAAAGG + Intronic
1202432631 Y:24802272-24802294 CAAAAACCTGAGAGAGAAAAAGG + Intronic
1202436608 Y:24845015-24845037 CAAAAACCTGACAGAGAAAAAGG - Intronic
1202437336 Y:24855866-24855888 CAAAAACCTGAGAGAGAAAAAGG - Intronic
1202440273 Y:24896714-24896736 CAAAAACCTGAGAGAGAAAAAGG - Intronic