ID: 920929752

View in Genome Browser
Species Human (GRCh38)
Location 1:210376345-210376367
Sequence GAATGTAAGGGGATTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920929752_920929761 23 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929761 1:210376391-210376413 TTTTAGCTGTCGTTAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 124
920929752_920929759 19 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929759 1:210376387-210376409 AGGGTTTTAGCTGTCGTTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 82
920929752_920929760 22 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929760 1:210376390-210376412 GTTTTAGCTGTCGTTAGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 78
920929752_920929757 0 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929757 1:210376368-210376390 GTTTTATATGTTACATCCAAGGG 0: 1
1: 0
2: 1
3: 11
4: 224
920929752_920929762 28 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929762 1:210376396-210376418 GCTGTCGTTAGTGGAGGGATAGG 0: 1
1: 0
2: 0
3: 5
4: 108
920929752_920929756 -1 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929756 1:210376367-210376389 CGTTTTATATGTTACATCCAAGG 0: 1
1: 0
2: 3
3: 8
4: 128
920929752_920929763 29 Left 920929752 1:210376345-210376367 CCATTCACAATCCCCTTACATTC 0: 1
1: 0
2: 1
3: 17
4: 220
Right 920929763 1:210376397-210376419 CTGTCGTTAGTGGAGGGATAGGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920929752 Original CRISPR GAATGTAAGGGGATTGTGAA TGG (reversed) Intronic
902116081 1:14122472-14122494 GAATCTCAGAGGATTGTGATGGG - Intergenic
903602689 1:24554113-24554135 GACAGTAAGGGGTTTGGGAAGGG - Intergenic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
905788068 1:40773847-40773869 GGATGTAAGGGGATCGTGCTGGG - Intergenic
907844219 1:58189413-58189435 GAATTTAAGTGGTTTGTGGAAGG + Intronic
908624337 1:66023048-66023070 GATTGTGTGGGGATTGTAAATGG + Intronic
910014398 1:82503601-82503623 GAAGGTAAGGAACTTGTGAAAGG + Intergenic
911573452 1:99545541-99545563 GAATGTAAGTGCATTGTGTTAGG - Intergenic
911687140 1:100790582-100790604 GAATTTAAGGCGAGTGTGAGAGG + Intergenic
912131983 1:106614817-106614839 AAATGTAAAGTGCTTGTGAAGGG - Intergenic
912494080 1:110080145-110080167 GAATGAAATGGGAATGGGAATGG - Intergenic
912494088 1:110080174-110080196 GAATGGAATGGGAATGGGAATGG - Intergenic
912530977 1:110321808-110321830 GCATGGAAGGGGATGGTGAAGGG - Intergenic
912620177 1:111147914-111147936 TAATGCAAGGGTATTGGGAATGG + Exonic
912669790 1:111615130-111615152 ACATGTAAGGGTATAGTGAAAGG + Intronic
912759837 1:112357080-112357102 GACTGGAAGGGGCTTGTGAGAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914228056 1:145738355-145738377 GACTGTAAAGGGATTGGAAAAGG - Intronic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915754905 1:158250114-158250136 AAAAGCAAGGGAATTGTGAAAGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918029632 1:180792638-180792660 GAAGAGAAGGGAATTGTGAAAGG + Intronic
919131925 1:193461911-193461933 GAGTGAAAGGGGAGTGTGCATGG + Intergenic
920279740 1:204833920-204833942 AAATGTGAGAGGATAGTGAAAGG + Intronic
920929752 1:210376345-210376367 GAATGTAAGGGGATTGTGAATGG - Intronic
922750800 1:228069225-228069247 GAGTGTAGGGGGATAGTGTAGGG + Intergenic
922751332 1:228071424-228071446 GAGTGTAGGGGGATAGTGTAGGG + Intergenic
923045509 1:230352808-230352830 GAATGGGAGGGGATGGAGAAGGG + Intronic
923279676 1:232431068-232431090 GAAAGTCAGGGAAGTGTGAAAGG - Intronic
924485104 1:244475088-244475110 AAATGAAAGGGCATTGGGAAGGG - Intronic
1062767171 10:74690-74712 GAAAGTAAGGGGAAGGAGAAGGG + Intergenic
1063581444 10:7311431-7311453 GAATGTAAAGTGATTTTTAAAGG + Intronic
1063648174 10:7906976-7906998 GAAAGTAAGGGGTTAGGGAAAGG - Intronic
1064026183 10:11850481-11850503 GAATGTACAGGGAAGGTGAAGGG + Intronic
1064754035 10:18558770-18558792 GAATGGAATGGAATTGAGAATGG + Intronic
1064754052 10:18558906-18558928 GAATGGAATGGAATTGAGAATGG + Intronic
1064755557 10:18569421-18569443 GAATGGAATGGAATTGAGAATGG - Intronic
1064755646 10:18569980-18570002 GAATGGAATGGAATTGAGAATGG - Intronic
1065070753 10:22021639-22021661 GAATGAGAGGGGAATTTGAAAGG + Intergenic
1065281623 10:24144865-24144887 GAATGTGAGGGGAGGGAGAAAGG - Intronic
1066240682 10:33531638-33531660 GAAAGAAAGGGGATTGGGGAAGG + Intergenic
1068515947 10:58025556-58025578 AAATGTAAGAGAATTGAGAAAGG - Intergenic
1068665760 10:59674272-59674294 GAATGTAAGAGCATAGTGCATGG - Intronic
1069039589 10:63681478-63681500 GAATGGAAGGCTCTTGTGAAAGG + Intergenic
1069856486 10:71443738-71443760 GAATGTAAGTGGATGTAGAAGGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070482570 10:76897442-76897464 AAATGTAAGAGGAATGTCAAAGG + Intronic
1071342776 10:84664049-84664071 GAATGTAATGGTAGTGTGTAGGG + Intergenic
1071700385 10:87926511-87926533 GAATGTAAGCGACTTGAGAATGG - Intronic
1072716413 10:97755639-97755661 GAATGTTAGGGGACTGTGGTGGG + Intronic
1073579381 10:104650372-104650394 GACTGTAAGTGAATTGTGTAGGG + Intronic
1075849821 10:125577779-125577801 GAAAGGAAGTGGATTGTGCAGGG - Intronic
1077294308 11:1817685-1817707 GAATGGAAGGGCATTGTGTCAGG + Intergenic
1077746111 11:4907743-4907765 GTATCTTAAGGGATTGTGAATGG - Exonic
1077796136 11:5494384-5494406 GTATGTAAGTGGACTGGGAAAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1081142781 11:39523383-39523405 GAATGTAAGTGAATTGGTAAAGG - Intergenic
1082822264 11:57552118-57552140 GAATGTAAAGGGTGTGGGAAGGG + Exonic
1083518218 11:63280817-63280839 GAAAGTAAGGGGATAGAAAATGG - Intronic
1084357094 11:68646916-68646938 GAATAGAAGTGGATTCTGAATGG - Intergenic
1087465743 11:98503153-98503175 GAATGAAAGGGGGTTGAGAGAGG - Intergenic
1087798191 11:102476506-102476528 GCATGTAAGGAGATGGTGAAAGG + Intronic
1092391352 12:8082696-8082718 GAATGAAAGGGGACTGGCAATGG - Intronic
1095586366 12:43854186-43854208 GAATTTAAGGGGAATTGGAAAGG + Intronic
1095691330 12:45092757-45092779 TCATGTAAGGGGAATGTAAAGGG + Intergenic
1096074445 12:48793839-48793861 GGATCTAAGGGGATGGGGAAGGG - Intergenic
1096394284 12:51253997-51254019 GATTGTAAGGGGCTGGAGAAGGG + Intronic
1098395002 12:70007668-70007690 GAAGGCAAGGGGAAAGTGAATGG + Intergenic
1099070160 12:78036278-78036300 AAATGTAAGAGGCTTGTGCAGGG + Intronic
1099305440 12:80949129-80949151 GCATTTAAGAGGATTGAGAATGG - Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1100596125 12:96073630-96073652 GCATGAAAGGGTCTTGTGAAGGG - Intergenic
1101190915 12:102331422-102331444 GAATGGAATGTAATTGTGAATGG - Intergenic
1103732584 12:123037685-123037707 GAATCTGAGAGGATTGAGAAAGG - Intronic
1104740418 12:131168054-131168076 GAATGTCAGGGAAGTGTGGAAGG - Intergenic
1106345229 13:28870493-28870515 CAATGTAAGGAGATGGGGAATGG - Intronic
1107749755 13:43552398-43552420 GAATGAAAGGGGAATGAGGAGGG - Intronic
1108075272 13:46672801-46672823 GAGTGATAGGGGATTGTAAAAGG + Intronic
1111129726 13:83959245-83959267 GAATGTAAGGTGATTGTAGCAGG - Intergenic
1111251845 13:85612209-85612231 GAATTTATAGTGATTGTGAATGG + Intergenic
1111311748 13:86496916-86496938 GAATGTAATTGGATTTTGACAGG + Intergenic
1113513611 13:110874340-110874362 GAATGTAGGGGGAATGTGGAGGG - Intergenic
1113939772 13:114012544-114012566 GAATGCATGGGGAGTGTGCATGG - Intronic
1113954049 13:114087379-114087401 GTATGTGATGGGATTCTGAATGG + Intronic
1114925940 14:27398686-27398708 GACTTTAAGAGGATTGTAAATGG + Intergenic
1116300516 14:43175360-43175382 TAATGAATGAGGATTGTGAATGG - Intergenic
1117071638 14:52062712-52062734 GAATTGAAGGGGATGGGGAAGGG + Intronic
1118473630 14:66097674-66097696 GAATGAAAGAGGTTTGTGGAAGG + Intergenic
1120891474 14:89495694-89495716 GAATGTAAGGGCATTGATAATGG - Intronic
1121773147 14:96570276-96570298 GTATGTATGGGGATTGAGAGGGG - Intergenic
1123916131 15:25029460-25029482 GAATGTAAGAGTAATGTGAAAGG - Intergenic
1125449541 15:39794160-39794182 GACTGGAAGGGCATTGGGAATGG + Intergenic
1127102961 15:55586785-55586807 GTATGTAAGGTGATCATGAAAGG - Intronic
1130402102 15:83566799-83566821 GAATGTCAGGTGAATGTGAGTGG + Intronic
1130601442 15:85277492-85277514 CAAGGTAAGGGGATTGTATAGGG - Intergenic
1131797375 15:96033436-96033458 AAATGCAAGGGAATTTTGAAAGG - Intergenic
1136049315 16:27639220-27639242 GAATCTGAGGGGCTTGGGAAGGG - Intronic
1136903379 16:34064450-34064472 GAATGGAATGGAATGGTGAAAGG + Intergenic
1136903537 16:34065533-34065555 GAATGGAATGGAATGGTGAAAGG + Intergenic
1137864179 16:51876356-51876378 GAATGTAAAGGAATTGAGAAGGG - Intergenic
1138295672 16:55883214-55883236 GAATCGAATGGAATTGTGAAAGG + Intronic
1138614984 16:58158105-58158127 GAAAGCATGGGGAATGTGAAGGG - Exonic
1143261925 17:5605920-5605942 GAAGATAAGGGGATGGAGAAAGG + Intronic
1146031003 17:29365981-29366003 TAATGTAAAAGTATTGTGAAAGG + Intergenic
1146514782 17:33480635-33480657 GAAAGTAAGGAGATGGTCAATGG - Intronic
1147889776 17:43709220-43709242 GAATTAAAGGGGCTAGTGAATGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1153682016 18:7509853-7509875 GAATGTAAAGGCCTTGTGATGGG - Intergenic
1155623041 18:27802981-27803003 GAATGGAAGGGGAAAGGGAAGGG + Intergenic
1155683877 18:28522534-28522556 GCATGTAATGAGACTGTGAATGG + Intergenic
1158975304 18:62705865-62705887 GAAATTGAGGGGATTGTGACTGG - Intergenic
1166021492 19:40034829-40034851 GAATGTAAGGAGTGTGGGAAAGG - Exonic
1166021564 19:40035585-40035607 GAATGTAAGGAGTGTGGGAAAGG - Exonic
1166024960 19:40074411-40074433 GAATGTAAGGGGTGTGGGAAAGG - Exonic
1166025033 19:40075168-40075190 GAATGTAAGGAGTGTGGGAAAGG - Exonic
1166025074 19:40075588-40075610 GAATGTAAGGAGTGTGGGAAAGG - Exonic
1166174338 19:41055346-41055368 GAAAGTGAGGGGATTGTGAATGG + Intergenic
1167390015 19:49188851-49188873 GAATTTAAGGGGATGGCGCAGGG - Intronic
926390648 2:12388176-12388198 AAATCTAAGCAGATTGTGAAAGG - Intergenic
927035546 2:19171484-19171506 GACTGTAAGGGCATTGCCAAAGG - Intergenic
927578870 2:24223736-24223758 GAATGTAAGGGGAAAGGGAAGGG + Intronic
932274680 2:70443069-70443091 GGAGGTAAGGGGATTGAGCAGGG + Intergenic
933225303 2:79741608-79741630 AAATGTATGCTGATTGTGAATGG + Intronic
933289393 2:80420990-80421012 GCATGTAGGTGGAATGTGAAGGG - Intronic
934078815 2:88451061-88451083 AAAGGAAAGGGGATTGTGATAGG - Intronic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935248109 2:101236916-101236938 GAAAGTAAAGGGATTAAGAATGG - Intronic
935989877 2:108709560-108709582 GAAAATAAAGGGATTGGGAAAGG + Intergenic
936025897 2:109031083-109031105 GAGTCTAAGGGTATTGTGATTGG + Intergenic
936699333 2:114991803-114991825 GATTGTATGGAGGTTGTGAATGG + Intronic
938231203 2:129660726-129660748 AAATATAAGGAGGTTGTGAAAGG - Intergenic
939038243 2:137158375-137158397 GAATGTAAAGGGATTGCCCAGGG - Intronic
942965720 2:181891277-181891299 GAATGAAAATGAATTGTGAAAGG - Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
944646557 2:201786133-201786155 GAATTTAAGGGGCAGGTGAAAGG - Intergenic
944870954 2:203911347-203911369 GAATGTAAGGGGTTGGAGGAGGG + Intergenic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
1169704070 20:8482832-8482854 GAATGTGAGGGTATTATGGATGG + Intronic
1170011383 20:11727827-11727849 GGATGAAAGGGGACTGGGAATGG + Intergenic
1170504157 20:17007494-17007516 GAATGTAAGAGGCTAGGGAATGG - Intergenic
1172224421 20:33295861-33295883 GGAAGGAAGGGGATTGGGAAGGG + Intronic
1177323828 21:19557278-19557300 GAAAGTAAGAGGATTTTTAAAGG + Intergenic
949140491 3:627443-627465 TAATGGGAGGTGATTGTGAAGGG - Intergenic
949742195 3:7249231-7249253 GAATGTAAGTAAATTGTGAAAGG - Intronic
950901731 3:16504074-16504096 GAAACTAAGGGCACTGTGAACGG - Intronic
951678930 3:25274381-25274403 GCATGTGAGGTGCTTGTGAAGGG - Intronic
953658986 3:44876791-44876813 GAAGGTAATGGAACTGTGAAGGG + Intronic
954658899 3:52215885-52215907 GAATTTAACCGGATTGTGACTGG - Intergenic
954830539 3:53417759-53417781 GAAGGTAAGGGGAGTCTGGATGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
960065324 3:113366469-113366491 GAATGTAACTGCATTGTGATAGG + Intronic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
961064672 3:123865206-123865228 GAATGTAAGGGCCTTGTTACAGG - Intronic
962900533 3:139757720-139757742 GAATGTGAAGGGAATGTGCAGGG + Intergenic
965930631 3:174038806-174038828 GAGTGTGAAGGGTTTGTGAAAGG - Intronic
966810210 3:183837190-183837212 AAATGTAAGAGGACTGTGAAAGG + Intronic
972406249 4:38749214-38749236 GAATGAAAGGTGATTGTTCAGGG - Intergenic
973192602 4:47402654-47402676 TAATTTAAGGGGAATGTGTAGGG - Intronic
974129735 4:57739187-57739209 AAGTGTATGGGGATTGGGAAAGG - Intergenic
976339202 4:83926820-83926842 GAATGTCGGAGGAATGTGAAGGG + Intergenic
977266250 4:94858864-94858886 GAATTTAAGTGGATTTGGAAGGG - Intronic
977318902 4:95486358-95486380 GAAAGTGAAGGGATTGTGGATGG - Intronic
977597225 4:98896403-98896425 GAATGGAAGGGGAAGGGGAAAGG + Intronic
978579915 4:110221213-110221235 GAATGAAATGGCAGTGTGAAGGG - Intergenic
978957716 4:114634662-114634684 AAATGTAAGAAGATTGTTAAAGG - Intronic
981142339 4:141283032-141283054 GAAGGTAAGCAGATGGTGAATGG - Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990566823 5:57037974-57037996 GAGTGCACTGGGATTGTGAATGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991646670 5:68807967-68807989 GAAGGGAAGGGGAGTGGGAAGGG + Intergenic
992056795 5:72998141-72998163 GAATGTAAGGGGAATGGGACAGG + Intronic
992373566 5:76169748-76169770 GAATTTGAGGGGCTTGAGAAAGG + Intronic
994141722 5:96348651-96348673 GAAAGTAAGAGGATTGAGGATGG + Intergenic
995358886 5:111270627-111270649 GAATTTAAGAGGAGTGAGAAAGG - Intronic
996717582 5:126600497-126600519 TAATGTAAGGGGCTTGAGCATGG - Exonic
997402845 5:133615913-133615935 GATGGAAAGGGAATTGTGAATGG + Intergenic
997949020 5:138227195-138227217 GAATTTAAATGGCTTGTGAAAGG - Intergenic
1001599963 5:172922465-172922487 GCAGGTAAGGGGATGGGGAATGG + Intronic
1002508468 5:179697409-179697431 GAATTCAATGGGATTCTGAAGGG - Intronic
1003264500 6:4553371-4553393 GAATGTAATGGGATGGGGAAGGG + Intergenic
1004261379 6:14110673-14110695 GAAAGTAAGGGAATGCTGAAGGG + Intergenic
1004620059 6:17324125-17324147 GAGTGTAAGGGAATGGTGTAAGG + Intergenic
1005345787 6:24888983-24889005 GAATGTAACTGGAGTTTGAAAGG - Intronic
1006567832 6:34974383-34974405 GAATGGAAGGGGAAGGGGAAGGG - Intronic
1008614589 6:53214068-53214090 GTATGTAAGGGGACTGGTAAAGG + Intergenic
1008677741 6:53838507-53838529 GAATGTATGGAGATGGTGATGGG + Intronic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1013344085 6:109243283-109243305 GAATGTCAGGGCAATGTAAATGG + Intergenic
1014279749 6:119428572-119428594 GAACTTAAGGGGATTGAGATAGG + Intergenic
1014396186 6:120928100-120928122 GATTGTAAGGGGTGTGTGATTGG - Intergenic
1015974497 6:138775284-138775306 TAAAGTAAGGGGATTGTGTAGGG + Intronic
1016783886 6:147989150-147989172 GAATGTAAGGGGAAACTGAGTGG + Intergenic
1016879613 6:148897924-148897946 AAATGGCAGGGGATTGTGAAAGG - Intronic
1018251749 6:161878399-161878421 GGATGAAAGGGGATGGTGATTGG - Intronic
1018822430 6:167383617-167383639 GGGTGTGAGGGGAATGTGAATGG + Intronic
1021765340 7:23943294-23943316 GAATGTAACTGAAATGTGAATGG + Intergenic
1023819661 7:43973464-43973486 GAATGTCAGGGGGTAGTGATTGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1029744710 7:102510433-102510455 GAATGTCAGGGGGTAGTGATTGG - Intronic
1029762701 7:102609595-102609617 GAATGTCAGGGGGTAGTGATTGG - Intronic
1029879961 7:103797779-103797801 GTATATAAAGGAATTGTGAAGGG + Intronic
1031414585 7:121480275-121480297 GGATGAAAGGGGAATGTGCAAGG - Intergenic
1031524285 7:122805700-122805722 GAATGTCAAGGGCTGGTGAAAGG + Intronic
1032421710 7:131785340-131785362 GAATGTGAAGAGATTGTAAAAGG + Intergenic
1033023248 7:137748584-137748606 GACTGTAAGAGGACTGTGAGGGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035811524 8:2495514-2495536 GAATGTCAGGTGACTGTCAAGGG - Intergenic
1037200651 8:16248740-16248762 GATTGTAAGGGGGTGGGGAATGG + Intronic
1038300027 8:26335994-26336016 GAATGGAAGAGGAAGGTGAAGGG - Intronic
1038483802 8:27919551-27919573 CAATGTCAGGGGAGTGTTAAGGG - Intronic
1038608741 8:29038882-29038904 GTATGACAGGGGGTTGTGAAAGG - Intronic
1042909305 8:73808836-73808858 GAATGTAAGGGGAATGGTGAGGG + Intronic
1043305674 8:78791292-78791314 GAAAATAAGGGAATTATGAATGG + Intronic
1045971059 8:108080932-108080954 GAAAGTACTGGGATTGAGAAAGG + Intronic
1047414716 8:124654792-124654814 GAATGTAAGGAAATTTTAAAGGG - Intronic
1050329028 9:4526855-4526877 TAAAGTAAGGGGATTATGCAGGG - Intronic
1052396005 9:27938845-27938867 GAATGAAAGGAGATTGTGCTTGG + Intergenic
1053316530 9:37056700-37056722 GAATGGAATGGGAATGGGAATGG + Intergenic
1055179410 9:73365501-73365523 GAATGGAAAGTGATTGTCAATGG - Intergenic
1056102662 9:83314649-83314671 AAAGGTAAAGAGATTGTGAAGGG - Intronic
1056328166 9:85499436-85499458 GAATGTAAGGTCTTTGTGTATGG - Intergenic
1057205125 9:93167290-93167312 GGTTGTAAGGAAATTGTGAAAGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186720702 X:12300615-12300637 GAATGCAAGGGGTTTGAGATAGG + Intronic
1187642435 X:21309222-21309244 GAATGGAAGAGGATAGAGAAAGG + Intergenic
1192451553 X:71248143-71248165 GAAGGTAAGGAGATGGGGAAGGG - Exonic
1192893608 X:75416724-75416746 GAATGAAAGAGGATGGAGAAAGG + Intronic
1193103213 X:77639126-77639148 GAAGGTGAGGGGATTATGCAGGG - Intronic
1194187479 X:90791432-90791454 AAATGGCAGGGGATTTTGAATGG + Intergenic
1194373361 X:93101844-93101866 GAATTTAAGGAGCTTGTTAACGG - Intergenic
1195152534 X:102086612-102086634 AAATGAAAGGAGATTGAGAAAGG - Intergenic
1196549034 X:116999080-116999102 GAATGTAAGTGGTTTGAGCATGG - Intergenic
1197300356 X:124772423-124772445 GAATGTAGGGGGACAGGGAACGG - Intronic
1198953045 X:142094743-142094765 GAATATGAGGGGATGGTTAATGG + Intergenic
1199066184 X:143421393-143421415 GAATGGAGGGGGAATGTGAAAGG + Intergenic
1201111139 Y:10800367-10800389 GAATGAAATGGAATTGAGAAGGG - Intergenic
1201140351 Y:11022632-11022654 GAATGGAATGGAATGGTGAAAGG - Intergenic