ID: 920930446

View in Genome Browser
Species Human (GRCh38)
Location 1:210382988-210383010
Sequence CAGTTAACTCATTTGTAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3806
Summary {0: 1, 1: 1, 2: 30, 3: 428, 4: 3346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920930438_920930446 30 Left 920930438 1:210382935-210382957 CCCGGCTCTGCCCCTTACTAGGT 0: 1
1: 3
2: 80
3: 533
4: 2027
Right 920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG 0: 1
1: 1
2: 30
3: 428
4: 3346
920930441_920930446 20 Left 920930441 1:210382945-210382967 CCCCTTACTAGGTTTGGATAAAT 0: 1
1: 0
2: 0
3: 17
4: 144
Right 920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG 0: 1
1: 1
2: 30
3: 428
4: 3346
920930443_920930446 18 Left 920930443 1:210382947-210382969 CCTTACTAGGTTTGGATAAATAA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG 0: 1
1: 1
2: 30
3: 428
4: 3346
920930439_920930446 29 Left 920930439 1:210382936-210382958 CCGGCTCTGCCCCTTACTAGGTT 0: 1
1: 1
2: 19
3: 175
4: 1004
Right 920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG 0: 1
1: 1
2: 30
3: 428
4: 3346
920930442_920930446 19 Left 920930442 1:210382946-210382968 CCCTTACTAGGTTTGGATAAATA 0: 1
1: 0
2: 0
3: 13
4: 284
Right 920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG 0: 1
1: 1
2: 30
3: 428
4: 3346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920930446 Original CRISPR CAGTTAACTCATTTGTAACA CGG Intronic
Too many off-targets to display for this crispr