ID: 920932943

View in Genome Browser
Species Human (GRCh38)
Location 1:210406058-210406080
Sequence GCCCAGGAAGGTGGTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920932940_920932943 -9 Left 920932940 1:210406044-210406066 CCTCTAGGGATAAAGCCCAGGAA 0: 1
1: 0
2: 1
3: 19
4: 172
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932938_920932943 3 Left 920932938 1:210406032-210406054 CCTGAATCACAGCCTCTAGGGAT 0: 1
1: 0
2: 1
3: 10
4: 188
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932934_920932943 10 Left 920932934 1:210406025-210406047 CCAACCTCCTGAATCACAGCCTC 0: 1
1: 0
2: 5
3: 40
4: 355
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932933_920932943 15 Left 920932933 1:210406020-210406042 CCTCTCCAACCTCCTGAATCACA 0: 1
1: 0
2: 9
3: 45
4: 453
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932935_920932943 6 Left 920932935 1:210406029-210406051 CCTCCTGAATCACAGCCTCTAGG 0: 1
1: 0
2: 2
3: 37
4: 303
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920932943 Original CRISPR GCCCAGGAAGGTGGTTTAAC AGG Intronic
900277463 1:1840768-1840790 GCCCAGGAAGGTGGCTTGAATGG + Intronic
900486487 1:2925137-2925159 GCCCAGGAAGGTGGGTACACAGG + Intergenic
902500482 1:16907865-16907887 GCCAAGGAAGGCGCTTTAATAGG - Intronic
903882553 1:26521524-26521546 TCCCAGGAAGCTGGGATAACAGG + Intergenic
908515875 1:64892402-64892424 TCCCAAGAAGGTGGGATAACAGG + Intronic
908532150 1:65044089-65044111 GCCGAGGCAGGTGGATTACCTGG - Intergenic
908767831 1:67570283-67570305 GCCCAGGAAGGTTGCATGACTGG + Intergenic
908956348 1:69633550-69633572 TCCCAAGTAGGTGGTATAACAGG + Intronic
911626616 1:100132150-100132172 GCCCAGTAAGGTGTTTTACAAGG + Intronic
912119625 1:106454497-106454519 GCCGAGGAAGGTGGATTATGAGG + Intergenic
912512315 1:110197919-110197941 GCCAAGGATGGGGGTTTACCTGG - Intronic
914433443 1:147640236-147640258 GCCCAGGAAAGTGGTAAAACTGG + Intronic
915600896 1:156922789-156922811 GCCCAGGAAATTGTTTTAGCAGG + Intronic
918329737 1:183447240-183447262 GCCCAGGCAGGTGGATTACAAGG + Intergenic
918595756 1:186290957-186290979 GCCAAGGAAGGTGGATTACAAGG + Intergenic
920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG + Intronic
923445799 1:234070039-234070061 CACCAGGAAGTTGGTTTAAATGG + Intronic
924907269 1:248469556-248469578 GCCCTGGCTGGTGTTTTAACAGG + Intergenic
924916841 1:248578557-248578579 GCCCTGGCTGGTGTTTTAACAGG - Intergenic
1063951667 10:11229072-11229094 GCCCAGGAAGGTGGGAGGACAGG + Intronic
1070212562 10:74341284-74341306 GCCCAGGCAGGTGGATTATGAGG + Intronic
1072085027 10:92070540-92070562 GCCTAGGAGGGTGGATTACCTGG + Intronic
1072215033 10:93280789-93280811 GCCCTGGAAGGGGGTTGAACTGG - Intergenic
1073840345 10:107491801-107491823 GCTCAGGTAGGGAGTTTAACTGG + Intergenic
1075666247 10:124233111-124233133 GGGCAGGAAGCTGGTTTAGCAGG - Intergenic
1075686412 10:124367894-124367916 GCCAAGGAAGATGGTGAAACAGG + Intergenic
1077333154 11:1992176-1992198 GCCCGGAAAGGCGGGTTAACTGG + Intergenic
1077530448 11:3092453-3092475 GCCCAGGAAGGTGGTCTGGCGGG + Exonic
1077824016 11:5784423-5784445 GCTCAGAAAGGTAGTTTATCGGG - Intronic
1080616732 11:33950922-33950944 TCCCAGGAAGCTGGTATTACAGG - Intergenic
1081351186 11:42054311-42054333 TCCTAGGAAGGTGGTGTATCAGG + Intergenic
1083361544 11:62112232-62112254 GCCCTGGGAGGTGGTTTTTCAGG + Intergenic
1083687189 11:64383603-64383625 CCCCAGGCAGGGGGCTTAACTGG - Intergenic
1086331426 11:85758230-85758252 GCTCAGGAAGCTGGCTGAACTGG - Intronic
1089827829 11:121294944-121294966 GCCAAGGGAGGTGGTGTAGCAGG - Intronic
1202816136 11_KI270721v1_random:47355-47377 GCCCGGAAAGGCGGGTTAACTGG + Intergenic
1091975015 12:4817378-4817400 GCACAGGAAAGTGGTTCATCAGG - Intronic
1093036321 12:14335607-14335629 GCCGAGGAAGGTGGATTACAAGG - Intergenic
1093789196 12:23227962-23227984 GCTCTAGAAAGTGGTTTAACTGG - Intergenic
1098165621 12:67694638-67694660 CCCCAGGAAGTTGGCTTAGCTGG - Intergenic
1098259630 12:68654894-68654916 GCCCAGCAATCTGTTTTAACTGG - Intronic
1103824403 12:123725166-123725188 GCCGAGGAAGGTGGATCAACTGG - Intronic
1104176725 12:126340406-126340428 GCAAAAGAAGGAGGTTTAACTGG + Intergenic
1110005026 13:70255480-70255502 GGCCAGGAATGTGTTTTAGCTGG - Intergenic
1110447775 13:75606513-75606535 GACCAGGAAGGAGGTTCAAGTGG + Intergenic
1110651475 13:77947368-77947390 GCCGAGGAAGGTGGATCACCTGG - Intergenic
1111581615 13:90230526-90230548 GCCCAGGAAGCTGGTAGAGCGGG - Intergenic
1111727370 13:92029705-92029727 ACCCAGGGAGTTGGTTAAACAGG - Intronic
1113309094 13:109112519-109112541 GCCGAGGCAGGTGGTTCACCTGG + Intronic
1114479525 14:23023803-23023825 ACCCAGGAAGGTAGATCAACAGG + Intronic
1117141657 14:52795994-52796016 GCCGAGGCAGGTGGATTACCTGG + Intergenic
1117419679 14:55531887-55531909 GCCGAGGCAGGTGGATTACCTGG + Intergenic
1121035368 14:90698997-90699019 GCCCTGGAAGGAGGTTCAGCAGG - Intronic
1124570479 15:30858399-30858421 CCCCAGGAAGCTGGATTAATTGG + Intergenic
1126672818 15:51131988-51132010 GCCCAGGCAGGTGAAGTAACGGG - Intergenic
1127628512 15:60803628-60803650 GCCCAGAAAGATGATTTGACAGG - Intronic
1128349151 15:66877592-66877614 GGCCATGAATGTGGTTTAAGAGG - Intergenic
1129622799 15:77164874-77164896 ACCCAGGAAGGATGTTGAACAGG + Intronic
1130661768 15:85836548-85836570 GCCGAGGAAGGTGGATTACAAGG + Intergenic
1131217249 15:90548400-90548422 GTCCAGCAAGGTGGTTTTCCTGG + Intronic
1131338472 15:91572927-91572949 GTCCAGGAATTTGTTTTAACAGG + Intergenic
1131826580 15:96326475-96326497 GCCGAGGACTGTGGTTTAAGGGG + Intronic
1139058582 16:63220255-63220277 GTCCAGAAAGGTGGAGTAACTGG - Intergenic
1142128518 16:88421807-88421829 GCCCAGAGAGGTGGTGTGACGGG - Intergenic
1142498223 17:317646-317668 GCTGAGGAAGGTGGATTAACTGG - Intronic
1143183792 17:4998890-4998912 GCCCAGGAATGTGGGTGATCGGG - Intronic
1144197931 17:12913677-12913699 GCCGAGGCAGGTGGATTACCTGG + Intronic
1144836035 17:18157178-18157200 TCGCAGGAAGGTGGTGTACCTGG + Exonic
1148752495 17:49953275-49953297 CCCAAGGAAGGTGGTTTAAGAGG + Intergenic
1148923367 17:51060268-51060290 GCCGAGGCAGGTGGATTACCTGG + Intronic
1149683780 17:58523305-58523327 GCCCCGGGAGGTGGTTGATCAGG + Intronic
1150345830 17:64403991-64404013 GCCCAGAAAGGTGCTGTAAAAGG - Intronic
1151740852 17:75980655-75980677 GCCGAGGCAGGTGGATCAACAGG - Intronic
1151794759 17:76336496-76336518 GCCGAGGCAGGTGGATTACCTGG + Intronic
1154328857 18:13413117-13413139 GCCCAGGATGGTGCTTTGAGTGG + Intronic
1156428557 18:37044561-37044583 GCCAAGGCAGGTGGATCAACAGG + Intronic
1157191735 18:45587713-45587735 GCCCAGGAAGGTGAAGTGACTGG + Intronic
1159015990 18:63101985-63102007 GCACAGGAAGGCGGCTTCACGGG - Intergenic
1159325149 18:66904963-66904985 ACAAAGGAAGGAGGTTTAACTGG - Intergenic
1160679254 19:405259-405281 TCCAAGGGAGGTGGTTTATCAGG + Intergenic
1161859008 19:6783824-6783846 GACTAGGAATGTGGTTAAACTGG + Intronic
1163164065 19:15483377-15483399 GCCAAGGCAGGTGGATTACCTGG - Intronic
1164055380 19:21617761-21617783 GCCGAGGCAGGTGGATTAAAAGG - Intergenic
1165346249 19:35250255-35250277 GCTCAGGGAGGTGCTTCAACAGG - Intronic
1165498234 19:36167053-36167075 GCCGAGGCAGGTGGATTACCTGG + Intergenic
1167807087 19:51795125-51795147 GCCAAGGAAGTTGGTTTTACAGG - Intronic
928244922 2:29618744-29618766 GCCAAGGCAGGTGGATTACCAGG + Intronic
928348889 2:30527993-30528015 GCCAAGCTAGGTGGATTAACAGG - Intronic
930099679 2:47593383-47593405 GCCGAGGAGGTTGGTTTTACAGG - Intergenic
930907215 2:56585828-56585850 GCCAAGGAAGGTGGTTCATGAGG - Intergenic
931065455 2:58581111-58581133 GCCCAGAAAGGTGGTTTAGTTGG + Intergenic
932411363 2:71549837-71549859 GCCCAGGTAGGTGGGCTAACAGG - Intronic
934692948 2:96375871-96375893 CCCCAGGAAACTGATTTAACAGG - Intergenic
935221783 2:101021440-101021462 GCCCAGGAACTTGGTTTAACAGG + Intronic
935336464 2:102021546-102021568 GCCGAGGCAGGTGGATCAACAGG - Intronic
940849508 2:158674507-158674529 GCAGAGGAAGGAGGTTTAACTGG - Intronic
944692965 2:202174197-202174219 GCCCAGGAGGGTGGATCACCTGG - Intronic
946530508 2:220565059-220565081 GCCAAGGCAGGTGGATTACCTGG - Intergenic
946945634 2:224818947-224818969 GCCCAGAAATTTGTTTTAACAGG - Intronic
1169270485 20:4195533-4195555 GCCCAGGAAGGTGGTTCCCGAGG - Intergenic
1173238818 20:41274920-41274942 GCCAAGGCAGGTGGATCAACTGG + Intronic
1174920150 20:54693354-54693376 GCCCAGGAAGATGTTTCAGCAGG + Intergenic
1180751232 22:18125795-18125817 GCCCAGTAACTTGGTTGAACAGG - Intronic
1183841957 22:40505997-40506019 GCCAAGGCAGGTGGATCAACAGG + Intronic
1184485971 22:44779801-44779823 GCCGAGGCAGGTGGATCAACCGG - Intronic
1184923633 22:47622968-47622990 GCCCAGGAATCTACTTTAACAGG - Intergenic
951580009 3:24152724-24152746 GCCCAGGCAGGTGGATCACCTGG + Intronic
952440316 3:33320711-33320733 GCCGAGGAAGGTGGATCACCAGG - Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
956061703 3:65355076-65355098 GCCCCGGGATGTGGTTTAAGTGG - Intronic
956291613 3:67666704-67666726 GCTCAGGAAGGTGGTGGAAAGGG - Intergenic
961216176 3:125162395-125162417 TCGCAGAAAGGTGGTTTCACTGG - Intronic
961659396 3:128460483-128460505 GGCCAGGAAGGTGGCTATACAGG - Intergenic
961783247 3:129333989-129334011 GCCCAGGAAAGTGGGTTGAGAGG + Intergenic
964264114 3:154875001-154875023 GCCCAGGAAGATGGCCTAATAGG + Intergenic
966346692 3:178988806-178988828 CCCCAGGAAGGTGGTTTGTGGGG - Intergenic
967763627 3:193252830-193252852 AACCAGGCAGGTAGTTTAACTGG - Intronic
970859839 4:20689385-20689407 GCCGAGGCAGGTGGATTAAGAGG - Intergenic
971349039 4:25840082-25840104 GCTCAGGGAGTTTGTTTAACTGG - Intronic
971371507 4:26023087-26023109 GCCCTGGAAGCTGGGTCAACTGG - Intergenic
973007696 4:45033259-45033281 GACCAGGAATCTGTTTTAACAGG + Intergenic
975702928 4:77083872-77083894 GTCCAGAAAGGTGGGATAACTGG + Intergenic
975816794 4:78225404-78225426 GCCCAGGGAGGCGGTTTGTCTGG + Intronic
978805417 4:112795259-112795281 TCCCAGGAATCTAGTTTAACTGG - Intergenic
982915926 4:161209129-161209151 GCCGAGGAGGGTGGATCAACAGG + Intergenic
983780312 4:171662343-171662365 GCCCAGGCAGGTGGATCACCTGG - Intergenic
987188004 5:15444798-15444820 GGCCAGCAAAGTGGTTTAATTGG - Intergenic
990691130 5:58365315-58365337 GCCAAGGAATGTGGTATATCTGG - Intergenic
991775275 5:70078983-70079005 GCCGAGGCAGGTGGATTACCTGG - Intergenic
991854570 5:70954403-70954425 GCCGAGGCAGGTGGATTACCTGG - Intergenic
994279684 5:97886382-97886404 GGCCAGGAAGGTTGCTTAGCAGG - Intergenic
995344193 5:111092644-111092666 GCCAAGGAGGGTGGTTTTCCTGG - Intronic
995584140 5:113629509-113629531 GTCAAGTAGGGTGGTTTAACTGG + Intergenic
1000976390 5:167769482-167769504 GCCAGGTAAGGTAGTTTAACTGG - Intronic
1001127087 5:169029454-169029476 GCCCAGCAATCTGTTTTAACAGG + Intronic
1001588086 5:172846683-172846705 GCGCAGGAAAGTGTTTTAAGAGG + Intronic
1002925128 6:1601627-1601649 GCGCAGGAAGGTGCTTTTAAAGG - Intergenic
1004602909 6:17167696-17167718 GCCAAGAAAGCTGGTTTAATTGG - Intergenic
1006812218 6:36827311-36827333 GCCAAGGTAGGAGGTTTAGCAGG - Intronic
1008532905 6:52481100-52481122 GCCCAGGATGGTGGTATCAGTGG + Intronic
1011814234 6:91169623-91169645 GTCCAGGAAGGTGGTTTCTCAGG + Intergenic
1016023697 6:139262138-139262160 GCCAAGGCAGGTGGATTAAGAGG - Intronic
1017319008 6:153066805-153066827 GCCAAGGAGGGTGGATTAAGAGG + Intronic
1019366105 7:633868-633890 GCCCAGGCAGGTGGTTTACAAGG - Intronic
1020026047 7:4900838-4900860 GCCCAGGGAGCTGGTTTATATGG - Intergenic
1024035798 7:45506486-45506508 GACCAGGAAGGGGCTTGAACAGG - Intergenic
1024196720 7:47066464-47066486 GCCCAGGAATTTGGTGTAATGGG - Intergenic
1027445046 7:78264005-78264027 GGTCAGAAAGGTGGTTTAAAAGG - Intronic
1027533179 7:79361481-79361503 GCCCAGGATGGGGGTTTGGCAGG - Intronic
1027929390 7:84511336-84511358 GCCCAGGAAAGTGGGATAATGGG + Intergenic
1030234311 7:107242313-107242335 GCCCAGAAAAGTGCTTTCACTGG + Intronic
1030549901 7:110945385-110945407 GCCCAGGAAGATGGGTTACCAGG - Intronic
1032909385 7:136412489-136412511 GCCTAGGGTGGTAGTTTAACCGG - Intergenic
1035486293 7:159228824-159228846 GCCCAGGAAGGCTGTTGGACAGG + Intergenic
1037779513 8:21858172-21858194 GCCCTGGAAAGTGGGTAAACAGG + Intergenic
1039507003 8:38059450-38059472 GCCAAGAAAAGAGGTTTAACTGG - Intronic
1042173216 8:66012489-66012511 GCCCAGGCAGGTGGATCAAGAGG + Intergenic
1043707309 8:83367598-83367620 GCACAGGAAGGTGAGTTAAGAGG + Intergenic
1043833831 8:85022146-85022168 CCCCAGGAAGGTTGTTTAGCGGG - Intergenic
1044378349 8:91502404-91502426 GCCAAGGAAGGTGGATCACCAGG - Intergenic
1044545005 8:93449565-93449587 GCCAAGGCAGGTGGATCAACAGG + Intergenic
1044667887 8:94649634-94649656 GCCCAGGTAGCTGGTATTACAGG + Intronic
1049204054 8:141355171-141355193 GCCCCGCAAGGTGGTGGAACTGG - Intergenic
1050785615 9:9397870-9397892 GCTCAGGAAGGTGGTGTATATGG - Intronic
1052613073 9:30800585-30800607 GCCCAGGAAGCTGGTGGAGCGGG + Intergenic
1053448600 9:38173065-38173087 CCCCAAGAAGGTGGCTTTACAGG + Intergenic
1057797608 9:98169861-98169883 GGCCAGGAAGGTGGGGTGACAGG - Intronic
1060300965 9:122374358-122374380 TCCCATGAAGGGGGTTTAGCAGG - Intronic
1060524938 9:124315200-124315222 GCCCAGGAAGCGGGTTTCCCTGG - Intronic
1062074093 9:134575106-134575128 GCCCAGAAAGGTGGTTGGCCAGG + Intergenic
1187631021 X:21172319-21172341 GCCGAGGCAGGTGGATTACCAGG - Intergenic
1190157620 X:48006547-48006569 GCCCAGGAACGTGGGTGCACAGG + Intronic
1190173392 X:48129432-48129454 GCCCAGGAACGTGGGTGCACAGG + Intergenic
1191808065 X:65156613-65156635 GCCGAGGCAGGTGGATTACCTGG - Intergenic
1192527781 X:71862324-71862346 GCCCATGAAAGTGGTTTCATGGG - Intergenic
1197559367 X:127999146-127999168 GCCCAGGGCAGTGGTTTCACAGG - Intergenic
1199173488 X:144758021-144758043 GACCAGGCAGTTGGTGTAACTGG - Intergenic
1200428269 Y:3046150-3046172 CCCCAGGGAGGAGGTTTGACGGG + Intergenic
1200780504 Y:7211239-7211261 TCCCAGGTAGCTGGTTTTACAGG - Intergenic
1200788980 Y:7283160-7283182 TACCAGGAAGCTGGCTTAACAGG - Intergenic
1202049137 Y:20762792-20762814 GCCCAGGCAGGTGGATTACGAGG - Intronic