ID: 920932943

View in Genome Browser
Species Human (GRCh38)
Location 1:210406058-210406080
Sequence GCCCAGGAAGGTGGTTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920932934_920932943 10 Left 920932934 1:210406025-210406047 CCAACCTCCTGAATCACAGCCTC 0: 1
1: 0
2: 5
3: 40
4: 355
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932938_920932943 3 Left 920932938 1:210406032-210406054 CCTGAATCACAGCCTCTAGGGAT 0: 1
1: 0
2: 1
3: 10
4: 188
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932940_920932943 -9 Left 920932940 1:210406044-210406066 CCTCTAGGGATAAAGCCCAGGAA 0: 1
1: 0
2: 1
3: 19
4: 172
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932933_920932943 15 Left 920932933 1:210406020-210406042 CCTCTCCAACCTCCTGAATCACA 0: 1
1: 0
2: 9
3: 45
4: 453
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163
920932935_920932943 6 Left 920932935 1:210406029-210406051 CCTCCTGAATCACAGCCTCTAGG 0: 1
1: 0
2: 2
3: 37
4: 303
Right 920932943 1:210406058-210406080 GCCCAGGAAGGTGGTTTAACAGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920932943 Original CRISPR GCCCAGGAAGGTGGTTTAAC AGG Intronic