ID: 920936604

View in Genome Browser
Species Human (GRCh38)
Location 1:210440710-210440732
Sequence CAATTTCAACACTGTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 16, 3: 67, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920936602_920936604 7 Left 920936602 1:210440680-210440702 CCAGGTGACTCCAGACAGTAATT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG 0: 1
1: 0
2: 16
3: 67
4: 316
920936603_920936604 -3 Left 920936603 1:210440690-210440712 CCAGACAGTAATTTGATGAACAA 0: 1
1: 0
2: 0
3: 14
4: 154
Right 920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG 0: 1
1: 0
2: 16
3: 67
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920936604 Original CRISPR CAATTTCAACACTGTGTACC TGG Intronic
901385210 1:8903696-8903718 CAATTTCAACACTATCTACCTGG - Intergenic
901488061 1:9579253-9579275 CACTTCCGACACTGTCTACCAGG + Intronic
901890956 1:12264232-12264254 CAATTTCAACATTGTGTCTCAGG - Intronic
902700678 1:18169791-18169813 CAAGTACCACACTGTGGACCAGG - Intronic
904056777 1:27676003-27676025 CAATTCTGACACTGTCTACCTGG + Intergenic
904730629 1:32588309-32588331 CAATTCCAATACTATGTACCTGG - Intronic
905582542 1:39093221-39093243 CAATTACAACACTGTCTACCTGG + Intronic
905692073 1:39950853-39950875 CAATTCCAACACTACCTACCTGG + Intergenic
906105976 1:43292883-43292905 CACTTTCCACTCTGTGTACAGGG + Intergenic
906482719 1:46210413-46210435 TAATTTCAACTCTGTCTACCTGG + Intronic
906796798 1:48702702-48702724 CTATTTCATCCCTGTTTACCAGG - Intronic
907134724 1:52129330-52129352 CACTTTCAAGACTGTGTAATGGG - Intergenic
907232344 1:53011702-53011724 CAATTCTAACACTATTTACCTGG - Intronic
907766516 1:57417742-57417764 CATTTTCCAAACTGTGTCCCAGG - Intronic
908606755 1:65805913-65805935 AAATTTCAAGATTATGTACCTGG + Intronic
911120011 1:94286926-94286948 CAATTCCAACACTATCAACCTGG + Intergenic
911286057 1:95994560-95994582 CAATGTCAACACAGTGAACAAGG + Intergenic
911352503 1:96772044-96772066 CAGTTTCAACACTGTCTGCCGGG + Intronic
912560897 1:110550856-110550878 CAATATCCACACTGTGTACAAGG - Intergenic
913187789 1:116385725-116385747 CAATTCCAACACTATCTACCTGG - Intronic
913717081 1:121547082-121547104 CACGTTCAACACTGTAAACCAGG - Intergenic
914406450 1:147378889-147378911 AAATTCCAACACTCTCTACCTGG + Intergenic
914674615 1:149899190-149899212 CAATTGCAATACTGGGTACTAGG - Intronic
916074010 1:161189910-161189932 CAATTTAAAAAATATGTACCGGG + Exonic
916301031 1:163274702-163274724 CAATTTGGACACTATCTACCTGG - Intronic
916824501 1:168430859-168430881 CCATTTCAGCCCTGGGTACCTGG + Intergenic
917489305 1:175484045-175484067 CTTATTCAACACTGTGTCCCTGG + Intronic
918075499 1:181168114-181168136 CAATTCGGACACTGTCTACCTGG - Intergenic
919493120 1:198229552-198229574 CAATTCCAACACTATCTTCCTGG - Intronic
920024430 1:202982929-202982951 TAATTTCAACATTGTGTCTCAGG + Intergenic
920720193 1:208380001-208380023 CAGTTCTAACACTGTCTACCTGG - Intergenic
920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG + Intronic
921436884 1:215134231-215134253 CAATTCTGACACTGTCTACCTGG + Intronic
921467645 1:215509315-215509337 CAATTCTGACACTGTCTACCTGG + Intergenic
922333425 1:224597929-224597951 CAATTCTGACACTGTGTACCTGG - Intronic
922482755 1:225950589-225950611 CAGTTTCAACACTGTGCTGCTGG + Intergenic
922483088 1:225952748-225952770 CAGTTTCAACACTGTGCTGCTGG + Intergenic
922754373 1:228086883-228086905 CAATTCTGACACTGTCTACCTGG - Intronic
922761393 1:228134098-228134120 CAATTCTAACACTATCTACCTGG + Intergenic
922770341 1:228178636-228178658 CAGTTTCTACACTGTCTGCCGGG - Exonic
922805249 1:228383325-228383347 CAATTCCAACACTGTCTACCTGG + Intergenic
922966820 1:229697514-229697536 CAATTCCCACACTGTCTACCTGG + Intergenic
923025364 1:230199589-230199611 CACTTTTAACACTGTGACCCAGG - Intronic
923916360 1:238510460-238510482 CAACTCCAACACTGTCTACCTGG - Intergenic
924063220 1:240197544-240197566 CAATTCTAACACTATCTACCTGG - Intronic
924609741 1:245563840-245563862 CAAGTTCAACACTGTCTCCCGGG - Intronic
1063305497 10:4895707-4895729 CATTTTCACCACAGTGTACGAGG + Intergenic
1063501270 10:6556995-6557017 CAATTCCAAGAGTGTGTACAGGG - Intronic
1064979297 10:21149822-21149844 CAATTCCAACCCTATCTACCTGG - Intronic
1065935779 10:30519447-30519469 CAATTCCACCACTATCTACCTGG + Intergenic
1067400725 10:45971508-45971530 CTCATTCAACACTGTATACCAGG + Intergenic
1067869069 10:49941065-49941087 CTCGTTCAACACTGTATACCAGG + Intronic
1069176801 10:65300256-65300278 CAATTCTGACACTGTCTACCTGG - Intergenic
1069763273 10:70831323-70831345 CAATTCTGACACTGTCTACCTGG + Intronic
1070418424 10:76211898-76211920 CAATGTCAATTCTGTGCACCAGG - Intronic
1070522280 10:77264538-77264560 CAATTCTTTCACTGTGTACCTGG - Intronic
1072594823 10:96861852-96861874 CAATTCCAACACTATCTACCTGG + Intronic
1073573785 10:104603608-104603630 CAATATGACCACTGTGTAGCTGG - Intergenic
1073898144 10:108186701-108186723 CAATTTGAACACACTGTCCCAGG + Intergenic
1075240080 10:120770400-120770422 TTATTTTAACACTGTGTATCTGG - Intergenic
1076859725 10:133135129-133135151 CATTTTAAACAGTGTTTACCAGG - Intergenic
1077086248 11:752939-752961 CAATTCCAACCCTGTCTACCTGG - Intronic
1078257564 11:9673075-9673097 CAATTCCAACACTATCTACCTGG + Intronic
1078379055 11:10823126-10823148 CAATTCCAACACTATCTACCTGG - Intronic
1078658415 11:13263842-13263864 CCATTTCATCACTCTCTACCTGG - Intergenic
1079643881 11:22839138-22839160 CAATTTAGACACTGAGGACCAGG + Intergenic
1079879741 11:25910995-25911017 CAATGACAACACTGTGAACAAGG + Intergenic
1080723581 11:34872774-34872796 CAATTTCAACAATATCTAACTGG - Intronic
1081499505 11:43652457-43652479 CAATTCCGACACTATCTACCTGG + Intronic
1083452793 11:62757344-62757366 TAATGCCAACACTGTCTACCTGG + Intergenic
1084156497 11:67316016-67316038 CAATTCCAACTCTGTCTACCGGG - Intergenic
1084338119 11:68473661-68473683 CAATTCCAACACCATCTACCTGG - Intronic
1084769955 11:71336181-71336203 CAATTTCACCACCGTGCACCTGG - Intergenic
1085693749 11:78686607-78686629 CAATTCCAACACTATCTACCTGG - Intronic
1088205121 11:107383308-107383330 CAGTTCCAACACTGTCTACCTGG - Intronic
1089736277 11:120552224-120552246 CAACTCCAACACTGTCTACCTGG - Intronic
1089970531 11:122689629-122689651 CAGTTCCAACACTGTCTACCTGG + Intronic
1090417521 11:126550861-126550883 CAATTCTGACACTGTCTACCTGG + Intronic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1090875413 11:130784683-130784705 CAATTTCAACCTTGTGTGCATGG + Intergenic
1091117159 11:133024166-133024188 ACATTTCAACACTGTTTTCCTGG + Intronic
1091137569 11:133205558-133205580 CAATTCTGACACTGTCTACCTGG - Intronic
1092346341 12:7718189-7718211 CAATTCCAGCACTGTCTACCTGG + Intergenic
1094443704 12:30507294-30507316 CAATTCCAACACTATCTACCTGG + Intergenic
1094481104 12:30882070-30882092 CAATTCCAACACTATCTACCTGG - Intergenic
1094537912 12:31338427-31338449 GAATTTCTACACTTGGTACCTGG + Intergenic
1094686496 12:32721670-32721692 CAATGCTAACACTGTTTACCTGG + Intronic
1095730985 12:45506461-45506483 CAATTCCAACACTATCTACCTGG - Intergenic
1095781625 12:46066583-46066605 TAATTTCAACAGTGTGTCTCAGG - Intergenic
1095782181 12:46072268-46072290 CAACTTCAGCACTGAGTTCCGGG - Intergenic
1097729834 12:63116147-63116169 CGATTCCAACACTATCTACCTGG + Intergenic
1097759436 12:63444654-63444676 CAATGTCTACTCTGTGTACCAGG - Intergenic
1098132275 12:67363088-67363110 CAATTATGACACTATGTACCTGG - Intergenic
1098493294 12:71106890-71106912 CAATTTTGACACTATCTACCTGG - Intronic
1099046145 12:77722229-77722251 TATTTTCTACACTGTGTACTGGG + Intergenic
1100233206 12:92631253-92631275 CACTTTCAGAACTGGGTACCAGG + Intergenic
1100292967 12:93235157-93235179 CAATTCAGACACTATGTACCTGG + Intergenic
1100657109 12:96659136-96659158 CAGTTTCTACACAATGTACCTGG + Intronic
1101582113 12:106050757-106050779 CAATTCCAACACTATCTACCTGG + Intergenic
1101772796 12:107767141-107767163 TAATTCCAACACTATCTACCTGG + Intergenic
1102840643 12:116116718-116116740 CAATTCTGACACTGTCTACCTGG - Intronic
1103316720 12:120062272-120062294 CAATAACATCACTGTGTTCCAGG - Intronic
1104268935 12:127264664-127264686 AAATTCCAACACTATCTACCTGG + Intergenic
1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG + Intronic
1107516999 13:41138872-41138894 CAATTCTGACACTGTCTACCTGG - Intergenic
1108866988 13:54936464-54936486 CAATTCCAACACTGTATACCCGG + Intergenic
1109148847 13:58818219-58818241 CAATTTGAAGACCGTGTCCCTGG + Intergenic
1109192302 13:59339989-59340011 TGATTCAAACACTGTGTACCAGG - Intergenic
1109478597 13:62918247-62918269 CAATTTCAATATTCTGTATCAGG - Intergenic
1109500149 13:63225200-63225222 CAATTTCAAAAATGTGTATAGGG + Intergenic
1111308566 13:86450084-86450106 CAATTCCAACACTATATACATGG + Intergenic
1111509379 13:89241560-89241582 CAATTCCAACACTGTCTACCTGG + Intergenic
1111511384 13:89268306-89268328 CCATTTCAGCAGGGTGTACCTGG - Intergenic
1111706864 13:91761419-91761441 CAATTCCAACACTATCTACCTGG + Intronic
1112592424 13:100776033-100776055 CAATTCCAACACTGTTTACCTGG + Intergenic
1112612828 13:100972871-100972893 CAATTTCATCACTATCTACCTGG + Intergenic
1115740807 14:36385804-36385826 TAATTTCAATATTGTGTCCCAGG - Intergenic
1115820739 14:37210210-37210232 CAATTCTGACACTGTGTACTTGG + Intronic
1116278693 14:42872070-42872092 CAAATTCAACAATATATACCTGG + Intergenic
1116396362 14:44452126-44452148 CAGTTTCAACACTATCTACATGG - Intergenic
1117969850 14:61240962-61240984 CAATTCTGACACTATGTACCTGG + Intronic
1118020975 14:61713866-61713888 CAATTCTAACACTATCTACCTGG - Intronic
1119007185 14:70942570-70942592 CAATTCTGACACTGTCTACCTGG + Intronic
1119551781 14:75519985-75520007 CACTTTCATCACTGTCTAACTGG + Intergenic
1120976129 14:90249660-90249682 CAATTTAGACACTGAGGACCAGG + Intergenic
1121420941 14:93813570-93813592 TAATTCCAACACTATCTACCTGG - Intergenic
1121519084 14:94573552-94573574 CAATTCCAACACTATCTACCTGG + Intronic
1123027131 14:105431091-105431113 CAATTTTGACACTGCTTACCTGG + Intronic
1123506916 15:20951560-20951582 CAATTTCAAAAAGCTGTACCTGG - Intergenic
1123564145 15:21525312-21525334 CAATTTCAAAAAGCTGTACCTGG - Intergenic
1123600399 15:21962596-21962618 CAATTTCAAAAAGCTGTACCTGG - Intergenic
1124181763 15:27482658-27482680 CATTTGCAACACTGTCTACTTGG + Intronic
1124207034 15:27730008-27730030 CAATTCCAACACTAACTACCTGG + Intergenic
1124391511 15:29262865-29262887 CAGTTCCAACACTATCTACCTGG - Intronic
1124434289 15:29634594-29634616 CAGTTCCAATACTGTCTACCTGG + Intergenic
1124649388 15:31463686-31463708 CAACTCCCACACTGTCTACCTGG - Intergenic
1125125139 15:36211235-36211257 CAATTCCAACACTATCTACCTGG + Intergenic
1126267068 15:46767289-46767311 TAATTTAAACACTGAGGACCAGG - Intergenic
1126697459 15:51338418-51338440 CAGTTCCAACACTATCTACCTGG + Intronic
1127029346 15:54844832-54844854 CAGTTCTAACACTGTCTACCTGG + Intergenic
1127619252 15:60717122-60717144 CAATTCTAACACTGTTTACCTGG - Intronic
1127897375 15:63314070-63314092 CAATTCCAACACTGTCTGCCTGG + Intergenic
1128864537 15:71104424-71104446 CGATTTTGACACTGTCTACCTGG + Intronic
1129067715 15:72921519-72921541 CAATTTTGACATTATGTACCTGG + Intergenic
1129197291 15:73976413-73976435 CAATTCCAACACTATCTACCTGG - Intergenic
1129339850 15:74878563-74878585 TAATTCCAACACTTTCTACCTGG + Intergenic
1129778732 15:78254805-78254827 CAATTCTGACACTGTCTACCTGG - Intergenic
1130210853 15:81920130-81920152 CAATTCCAACACTATCTACCTGG - Intergenic
1202972504 15_KI270727v1_random:252408-252430 CAATTTCAAAAAGCTGTACCTGG - Intergenic
1133039364 16:3052215-3052237 GGATCTCAACCCTGTGTACCTGG - Intronic
1133043210 16:3071848-3071870 GGATCTCAACCCTGTGTACCTGG - Intronic
1133107835 16:3525204-3525226 CATTTTAAACATTGGGTACCTGG + Intronic
1135091152 16:19519001-19519023 CAATTTTGACACTATCTACCTGG + Intronic
1135236519 16:20761464-20761486 TTAGTTCAACACTGTCTACCTGG - Intronic
1135387068 16:22051846-22051868 CAATTCTGACACTGTCTACCTGG - Intronic
1135679678 16:24445751-24445773 CAATTCTGACACTATGTACCAGG - Intergenic
1139260041 16:65582791-65582813 CAATTTCCACACTGTCTACCTGG - Intergenic
1139637718 16:68268282-68268304 CAATCCCAACACTATCTACCTGG - Intronic
1140530518 16:75661957-75661979 CAATTCCAGCACTGCCTACCTGG + Intronic
1140536691 16:75716255-75716277 CAATTCTGACACTATGTACCTGG + Intronic
1141078903 16:81033958-81033980 CAATTCCAACACTAACTACCTGG + Intergenic
1143540993 17:7568934-7568956 CAATTCCAACACTATCTACCTGG - Intronic
1144462985 17:15473084-15473106 CAGTTTCAGCACTGTCTACTTGG - Intronic
1146684975 17:34835501-34835523 CATTTTAGACACTGGGTACCTGG + Intergenic
1147514128 17:41100199-41100221 CACGTTCAACACTGTATTCCTGG - Intronic
1149185521 17:53992714-53992736 TAATTCCAACACTATCTACCTGG + Intergenic
1149268201 17:54950983-54951005 CAATTCCAACACCATCTACCTGG + Intronic
1149354490 17:55826096-55826118 GAATTTGAACCCAGTGTACCTGG + Intronic
1151255293 17:72871939-72871961 CAATTCTGCCACTGTGTACCTGG - Intronic
1152051277 17:77980586-77980608 CCATTTCAACATTATCTACCTGG + Intergenic
1153157021 18:2161469-2161491 CAATTTAGACACTGAGGACCAGG + Intergenic
1153415147 18:4838225-4838247 CAATTCCAACACTGTCTACCTGG + Intergenic
1155722825 18:29039882-29039904 CAATTTAAAAATTGTGTTCCAGG - Intergenic
1157373445 18:47139709-47139731 CAGTTCCAACACTGTCTACCTGG - Intronic
1157807322 18:50667864-50667886 CAATTCCAACACTATTTACCTGG + Intronic
1158024236 18:52877144-52877166 CAATCTCAACACTGTTGACTTGG + Intronic
1158509514 18:58078152-58078174 CAATCTCATCACTGCCTACCTGG + Intronic
1158881189 18:61780992-61781014 CAATTCCGACACTGTCTATCTGG - Intergenic
1159017694 18:63115028-63115050 CAGTTCCAACACTGTCTACCTGG - Intergenic
1166500831 19:43339991-43340013 CAGTTTCCACACTGTAAACCAGG - Intergenic
1166505291 19:43367669-43367691 CAGTTTCCACACTGTAAACCAGG - Intergenic
1166509268 19:43393426-43393448 CAGTTTCCACACTGTAAACCAGG + Intergenic
1167810431 19:51825002-51825024 AAATTCCAACACTATCTACCTGG + Exonic
1167869438 19:52355543-52355565 CATTTCTAACACTGTCTACCTGG + Intronic
1167966334 19:53150198-53150220 CAATTCTGACACTGTCTACCTGG - Intronic
1168450019 19:56459041-56459063 CAATTCTGACACTGTCTACCTGG - Intronic
925241680 2:2336673-2336695 CAATTACTACAGTGTGGACCGGG - Intergenic
925339137 2:3123350-3123372 CAATTTTAAAACTGAGTACCTGG + Intergenic
926454423 2:13047257-13047279 CAATTTCAAGAATGTTTACGAGG + Intergenic
927593199 2:24374480-24374502 CAATTCTTACACTGTTTACCTGG - Intergenic
929463750 2:42126246-42126268 CAATTGCCACACTGGGCACCAGG + Intergenic
929805754 2:45143527-45143549 CCCTTTCGACAGTGTGTACCAGG - Intergenic
930816835 2:55607267-55607289 CACCTTCGACACTGTTTACCCGG + Intronic
931045993 2:58353665-58353687 CAATCTCAACCCTGCGTTCCTGG - Intergenic
931107282 2:59070308-59070330 CATTCTCAACACAGTGTTCCAGG + Intergenic
931439853 2:62281157-62281179 CACCTTCAACTCTGTGTACTTGG + Intergenic
931612468 2:64117107-64117129 TAATTTCAATATTGTGTCCCAGG - Intronic
931829576 2:66036825-66036847 CAATTTTGACACTATCTACCTGG - Intergenic
932081464 2:68719501-68719523 CATTTTCAACACTTTGCATCTGG - Intronic
933287675 2:80401924-80401946 CAATTCTAACACTATCTACCTGG + Intronic
933725875 2:85426918-85426940 CAATTCCAACACTACCTACCTGG - Intronic
933790651 2:85881363-85881385 CAACTTTAAAACTGTGTAACAGG + Intronic
934050545 2:88206849-88206871 CAATTCTAACACTATCTACCAGG - Intergenic
934106050 2:88695362-88695384 CAATTTCAACACTCTCTACCTGG - Intronic
935985222 2:108666096-108666118 CAATTCCCACACTATCTACCTGG + Intronic
936137656 2:109909742-109909764 CAATTCCCACACTATCTACCTGG + Intergenic
936207041 2:110461743-110461765 CAATTCCCACACTATCTACCTGG - Intronic
936595174 2:113840591-113840613 CAGTTCCGACACTGTCTACCTGG - Intergenic
936602385 2:113910596-113910618 CAATTCCAATACTATCTACCTGG - Intronic
936820683 2:116516954-116516976 AAAGTTCAACACTGTGTTGCAGG + Intergenic
937404741 2:121616472-121616494 AAATTTCAACCCTGTTTTCCAGG - Intronic
939154302 2:138505929-138505951 CAATTTCAACTTTCTGGACCTGG + Intronic
939186026 2:138861697-138861719 TAATTTCAATATTGTGTCCCAGG + Intergenic
940190806 2:151038086-151038108 CAATTCTGACACTGTCTACCTGG - Intronic
941511993 2:166423052-166423074 AAAGTTCAACACTTTGTTCCTGG - Intronic
942318659 2:174717056-174717078 CAGTGTCAACACTGTGTACAAGG - Intergenic
942867743 2:180696854-180696876 CATTTTCTACACTTTCTACCTGG - Intergenic
944578200 2:201110283-201110305 TAAATTAAACACTATGTACCAGG - Intergenic
945517631 2:210782772-210782794 CAATTCCAACACTATCTATCTGG + Intergenic
946110878 2:217415149-217415171 CAAGTTCAACAATATGTACAAGG + Intronic
947294755 2:228618066-228618088 CAATTCTGACACTGTATACCTGG - Intergenic
947537706 2:230951231-230951253 CAATTCCAACACTGTCTACCTGG - Intronic
948389692 2:237603021-237603043 CAATTCTAACACTGTCCACCTGG - Intergenic
948860496 2:240750486-240750508 CGATTGCCACACGGTGTACCAGG + Exonic
1170123658 20:12938146-12938168 CAATTCTGACACTGTCTACCTGG + Intergenic
1170254325 20:14323124-14323146 TAATCCCAACACTGTCTACCTGG + Exonic
1171403977 20:24897483-24897505 CATTTCCAACCCTGTCTACCTGG + Intergenic
1172354830 20:34272405-34272427 CAATTCCAACACTATCTACTTGG + Intergenic
1172491845 20:35345342-35345364 CAATTCCAACATTGTGTACTCGG - Intronic
1172862694 20:38067798-38067820 CATTTTCAGCACTGTGCCCCGGG + Intronic
1173061413 20:39665156-39665178 CAATTTGGGCACTGTCTACCTGG - Intergenic
1175165262 20:57039046-57039068 CAGCTTCAAGACTGTGTGCCTGG + Intergenic
1175449015 20:59046547-59046569 CAATTCCAACACCATCTACCTGG - Intergenic
1175640623 20:60626909-60626931 CAATTACGACACCGTCTACCCGG + Intergenic
1177557743 21:22714323-22714345 CAATTCCAACACTGTCTACCTGG - Intergenic
1178386433 21:32154599-32154621 CAATTTAAACACTGAGGACCAGG - Intergenic
1179274622 21:39880850-39880872 CAATTTAAACATTGTTTTCCAGG - Intronic
1180786167 22:18549053-18549075 CAATGTCCACACGGTGAACCGGG - Intergenic
1181131452 22:20734779-20734801 CAATGTCCACACGGTGAACCGGG - Intronic
1181243089 22:21488607-21488629 CAATGTCCACACGGTGAACCGGG - Intergenic
1181719705 22:24764147-24764169 CAATTTCAACCCTGGGGTCCCGG + Intronic
1183971280 22:41479405-41479427 CAGTTTCATCACTGTGAAACAGG - Intronic
1184125046 22:42481052-42481074 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184133261 22:42530513-42530535 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184313937 22:43667601-43667623 CTTTTTCAACCCTGTGTGCCCGG - Intronic
1184575218 22:45358430-45358452 CAATTCTGACACTGTCTACCTGG - Intronic
949512444 3:4778623-4778645 CAGATTCAACCTTGTGTACCTGG + Intronic
949881736 3:8666698-8666720 CAATTCCAACACGATTTACCCGG + Intronic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
951768640 3:26229704-26229726 CAATGTAAACACTGTGCCCCAGG + Intergenic
952773565 3:37023299-37023321 TAATTCCAACACTGTCTACTTGG + Intronic
952917702 3:38261630-38261652 CAATTCCAACACTATGTACTTGG - Intergenic
953222072 3:40980582-40980604 CAATTCCGACACTATCTACCTGG - Intergenic
953797571 3:45997179-45997201 CAATTCCGACACTATCTACCTGG + Intergenic
954565832 3:51599082-51599104 CAATTCTAACACTATCTACCTGG - Intronic
957670993 3:83302769-83302791 TAATTCCAACACTATCTACCTGG + Intergenic
960468067 3:118023386-118023408 CTATTTCAACTCTGTGTCTCAGG + Intergenic
961072282 3:123944097-123944119 CAATTCCAACACTATCTACCTGG - Intronic
961855794 3:129869566-129869588 CAATTCTGACACTGTCTACCTGG - Intronic
962194801 3:133352420-133352442 CAATTTTTATACTGTCTACCTGG + Intronic
963198628 3:142563618-142563640 TAATTTCAATACTGTGTCTCAGG - Intronic
963756553 3:149240236-149240258 CAATTTTGACACTATCTACCTGG - Intergenic
964065214 3:152569833-152569855 TAATTTCAACAGTGTCTCCCTGG + Intergenic
964519939 3:157554166-157554188 CAATTCTGACACTGTCTACCTGG - Intronic
965754878 3:172015522-172015544 CAGTTCCAACACTATATACCTGG - Intergenic
966357397 3:179095566-179095588 CATTTTATACTCTGTGTACCAGG - Intergenic
967195503 3:187022187-187022209 CAGTTCCAACACTATCTACCTGG - Intronic
967218988 3:187233577-187233599 CAGTTTCAACACTTTGAAACTGG + Intronic
967594703 3:191315477-191315499 CAATTCCGACACTATCTACCTGG - Intronic
968724109 4:2233547-2233569 AATTTTCCACACTGTGTATCAGG - Intronic
971915583 4:32866421-32866443 TAATTCTAACACTGTCTACCTGG - Intergenic
973078057 4:45955545-45955567 CAATTCCAACACTATCTATCTGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973755396 4:54068752-54068774 CAATTCCAGCACTCTCTACCTGG + Intronic
973919466 4:55670306-55670328 CAATTTTAACACTATCTACCTGG + Intergenic
976495779 4:85727619-85727641 CAATTTCAGCAATGTATACTCGG - Intronic
976521742 4:86035702-86035724 CAATTTCTAAGCTGAGTACCTGG + Intronic
976657783 4:87507689-87507711 GAATTCTGACACTGTGTACCTGG + Intronic
976989882 4:91353104-91353126 CAATTTCAACATCTTGTAGCAGG + Intronic
977401146 4:96534166-96534188 CAATTTCAATATTGTGTGTCAGG - Intergenic
977608608 4:99009472-99009494 CAATTCCAACACAATGTACAAGG + Intronic
977718410 4:100209755-100209777 CAATTCCTACACTATCTACCTGG - Intergenic
980636632 4:135514103-135514125 TAATTTCAACACTGTCCAGCTGG - Intergenic
980808881 4:137849747-137849769 CAACTTAAACACTGTGTAGAGGG - Intergenic
981232075 4:142368632-142368654 ACATTTCAACACTGAGTACTGGG - Intronic
981742418 4:148016672-148016694 CAGTTCCAACACCGTCTACCTGG + Intronic
982923582 4:161306019-161306041 CAAATTCAACACTGTTTTCTTGG - Intergenic
984232512 4:177115748-177115770 CAATTCTGACACTGTCTACCTGG - Intergenic
984905441 4:184621632-184621654 CAATTCTAACACTATCTACCTGG - Intergenic
985239460 4:187914679-187914701 CAATTGCATCACTGTGCTCCAGG + Intergenic
985303684 4:188516074-188516096 CATGCACAACACTGTGTACCTGG - Intergenic
986848460 5:11782491-11782513 AAATTCCAACCATGTGTACCTGG + Intronic
987719579 5:21616684-21616706 CAATTCGGACACTGTCTACCTGG - Intergenic
987830453 5:23088469-23088491 CAATCTCTACATTGTGAACCTGG - Intergenic
988494547 5:31733908-31733930 CAATTCTGACACTGTCTACCTGG + Intronic
988894450 5:35656976-35656998 CCATTCCACCACTGTGGACCAGG - Intronic
990037469 5:51339009-51339031 CATTTTCAACACTGAGTAAATGG - Intergenic
990139828 5:52690329-52690351 CAATTTCAAAACTGCCTCCCAGG + Intergenic
990775393 5:59300727-59300749 CAGTTCCAACGCTGTCTACCTGG + Intronic
991697750 5:69288806-69288828 CAATTCTCACACTGTCTACCTGG - Intronic
992212281 5:74492733-74492755 CAATTCTGACACTGTCTACCTGG + Intergenic
992395951 5:76369860-76369882 CAATTCTGACACTGTCTACCTGG + Intergenic
993189880 5:84668599-84668621 CAATTCCAACACTATCTACCTGG - Intergenic
993383283 5:87232742-87232764 CAATCCTAACACTGTGTACCTGG - Intergenic
993810499 5:92470438-92470460 CAATTCCAACACAATCTACCTGG + Intergenic
994227028 5:97264901-97264923 CAATTCCAACACCATCTACCTGG + Intergenic
995379662 5:111517959-111517981 CAATTTGGACACTATCTACCTGG - Intergenic
996707705 5:126513766-126513788 CAATTCCAACACTGTCTACTCGG - Intergenic
997080053 5:130727159-130727181 CAATTTCAACAGTCTCTACCTGG - Intergenic
998329263 5:141309468-141309490 CAATTCCAACACTATCTACCTGG + Intergenic
999432427 5:151535793-151535815 CAATTCCAACACTATCTACCTGG - Intronic
999809467 5:155114463-155114485 CCCTTTCAACACAGTGTTCCAGG - Intergenic
1001489730 5:172146892-172146914 CAATTCCGACACTATCTACCGGG + Intronic
1001582698 5:172809709-172809731 CAATTTCAACACTATCTACCTGG - Intergenic
1001822360 5:174720368-174720390 CTAATTCAACACGGTGTCCCTGG - Intergenic
1002544090 5:179926859-179926881 CAGTTCCAACGCTGTCTACCTGG - Intronic
1002626405 5:180532630-180532652 CAATTCCAACACTGTCTTCCTGG + Intronic
1002659791 5:180783861-180783883 CAGTTCCAACCCTGTCTACCTGG - Intergenic
1004278189 6:14256640-14256662 CAATTCCAACACTCCCTACCTGG + Intergenic
1004394401 6:15235505-15235527 CAATTCCAACACTATCCACCTGG + Intergenic
1004590956 6:17051037-17051059 CAATTCCGACACTGTCTGCCTGG - Intergenic
1004736417 6:18410603-18410625 CACTTCCAACAATGTGTCCCAGG - Intronic
1005152905 6:22772926-22772948 CAATTCCAACACCGTCTACCGGG - Intergenic
1005222483 6:23602433-23602455 CAATTCCGGCACTGTCTACCTGG - Intergenic
1005879565 6:30045507-30045529 CAATGTCAACACTGTCTACCTGG + Intergenic
1006497790 6:34436426-34436448 CAATTCCCACACTATCTACCTGG + Intergenic
1007134347 6:39507225-39507247 CAATTCTGACACTGTCTACCTGG - Intronic
1007674795 6:43584612-43584634 CAATTCCAACACTGTCTACCTGG + Intronic
1008767011 6:54930148-54930170 CAATTTCAATAATGTAGACCTGG - Intronic
1008897719 6:56576492-56576514 CAATTCTGACACTGTCTACCTGG - Intronic
1010426482 6:75733892-75733914 CAATTCTGACACTGTCTACCTGG - Intergenic
1010765281 6:79771836-79771858 CAATTCCGACACTATCTACCTGG + Intergenic
1011047242 6:83098397-83098419 CAATTTGGACACTATCTACCTGG + Intronic
1011337239 6:86275023-86275045 CAATTTTCACACTGTCTATCTGG - Intergenic
1011381113 6:86743186-86743208 CAATTCTGACACTGTCTACCTGG + Intergenic
1013510477 6:110840278-110840300 CAATTCCGACACTGTCTACCTGG + Intronic
1014107568 6:117584273-117584295 CAATTTTGACACTATCTACCTGG + Intronic
1015593422 6:134843719-134843741 CAATTCCAACACTATCTACCTGG - Intergenic
1015860558 6:137674428-137674450 CAATGTAGACACAGTGTACCAGG - Intergenic
1015976659 6:138797790-138797812 CAGTTCTGACACTGTGTACCTGG + Intronic
1016207756 6:141490597-141490619 CAATTCCCACACTCTCTACCTGG + Intergenic
1016732092 6:147438183-147438205 CCATTTCAACACTGTAAACTTGG + Intergenic
1018011967 6:159678805-159678827 CAATTCTGACACTGTCTACCTGG - Exonic
1018379335 6:163243510-163243532 CATTTCCAAGACTGTGTAGCTGG + Intronic
1020334635 7:7053186-7053208 CAGTTCCAACACTATCTACCTGG - Intergenic
1021699034 7:23299774-23299796 CAATTTCTTCACTGTGAAACGGG - Intronic
1023688522 7:42762636-42762658 CACTTTGACAACTGTGTACCTGG + Intergenic
1023755211 7:43409735-43409757 CAAGTTAAACAGTGTGTAACTGG + Intronic
1024716947 7:52089852-52089874 TAATTTCAACATTGTGTCTCAGG + Intergenic
1027809680 7:82879400-82879422 CAATTTCTCCACTATGTCCCGGG + Exonic
1028029436 7:85891617-85891639 CAATTTCAGGAATGTGTAACTGG + Intergenic
1030780867 7:113598140-113598162 CAATTCCAATACTGTCTACCTGG - Intergenic
1031479188 7:122257662-122257684 CAATTGCAACATCGTCTACCTGG - Intergenic
1032180879 7:129676453-129676475 TAATTTCAATACTGTGTCTCAGG + Intronic
1035353897 7:158265698-158265720 CAAATGCCACGCTGTGTACCCGG - Intronic
1036157270 8:6354187-6354209 AAATTTCATCACTGTGCTCCTGG - Intergenic
1037264777 8:17046245-17046267 CAATTCTGACACTGTGTACCTGG - Intronic
1037442028 8:18926798-18926820 CATTTCCAACACTATCTACCCGG + Intronic
1038298829 8:26323381-26323403 CAGTTCCAACACTGTCTACCTGG + Intronic
1039229761 8:35430612-35430634 CAATTCCAACACTATCTACCTGG - Intronic
1040946219 8:52887139-52887161 CAAGTTTAACACTATCTACCTGG - Intergenic
1042149660 8:65768027-65768049 CAGTTCCAACACTGTCTACCTGG - Intronic
1042718388 8:71801014-71801036 CATCCTCAAGACTGTGTACCAGG - Intergenic
1043581681 8:81721956-81721978 TTATTGCAACACTGTGTGCCCGG - Intronic
1045347762 8:101310118-101310140 CAATTCTGACACTATGTACCTGG + Intergenic
1045465416 8:102465050-102465072 CTATTTCAACATTGTTCACCAGG + Intergenic
1045991599 8:108314803-108314825 CAATTCTGACACTGTTTACCTGG - Intronic
1046508106 8:115162201-115162223 CAATTTCATCACTGTTTAGTGGG - Intergenic
1048604958 8:135957983-135958005 CAATTTCAATATTGTGTCTCAGG - Intergenic
1048871577 8:138803599-138803621 CAAGTCCATCCCTGTGTACCTGG + Intronic
1048879583 8:138861320-138861342 TAAGTTCAAGGCTGTGTACCTGG - Intronic
1049966426 9:784418-784440 CAACTCCAACACTCTCTACCTGG + Intergenic
1050376433 9:4978690-4978712 CAAATTTAACACTGTGTAACTGG + Intergenic
1050460677 9:5874933-5874955 CAACTCCAACACTATCTACCTGG - Intergenic
1052414337 9:28158001-28158023 CAACTTTCACACTGGGTACCAGG - Intronic
1052950075 9:34201728-34201750 CAATGCCGACACTGTCTACCTGG + Intronic
1054918918 9:70522484-70522506 CAATTCTGACACTGTCTACCTGG + Intergenic
1055042756 9:71893258-71893280 CAATTCCAACATTATCTACCTGG + Intronic
1055135757 9:72827109-72827131 CAAATTCAACACTGATTACATGG + Intronic
1057035316 9:91807649-91807671 CACTTTAGACACTGTCTACCTGG - Intronic
1057044309 9:91873126-91873148 CAATGTTGACACTGTGTATCCGG - Intronic
1058508188 9:105688044-105688066 CATATTCAACTCTGTGTATCCGG - Intergenic
1058786398 9:108393247-108393269 CAAGTTCACCTCTGTGTTCCTGG - Intergenic
1059826468 9:118035271-118035293 CAATTTCGACACTGTCTACCTGG + Intergenic
1059892508 9:118818535-118818557 CAATTCCAACACTATCTACCTGG + Intergenic
1060129204 9:121078565-121078587 CAATTCTGACACTGTCTACCTGG + Intronic
1061721411 9:132553991-132554013 CAATGCCTACACTGTGTGCCAGG + Intronic
1186837189 X:13449887-13449909 CAATTCCAACACTATCTACCTGG + Intergenic
1187979616 X:24741680-24741702 AAATTTCAACACGCTGCACCTGG - Intronic
1189827781 X:44937660-44937682 TAATTTCAATACTGTGTCTCAGG - Intronic
1189948509 X:46204414-46204436 CAAATTCAACACTATCTACCTGG - Intergenic
1191712457 X:64164878-64164900 CAATTCCAACACTATCTACCTGG - Intergenic
1193155602 X:78170005-78170027 CAATTTTTACACTGTGTGCATGG + Intergenic
1193716511 X:84940551-84940573 CAATTTAGACACTGAGGACCGGG - Intergenic
1193891811 X:87056428-87056450 CAATTTCAAAACTTAGTACAAGG + Intergenic
1196841372 X:119862256-119862278 CAATTCCAACATTGCCTACCTGG - Intergenic
1198256905 X:134932033-134932055 GAATTCCAACACTCTCTACCTGG + Intergenic
1200839601 Y:7767577-7767599 CAATTTCAACAAAGTTTACCAGG + Intergenic
1202343943 Y:23901215-23901237 TAATCTCAGCACTGTGTACTTGG + Intergenic
1202526825 Y:25768869-25768891 TAATCTCAGCACTGTGTACTTGG - Intergenic